Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'Error while loading shared libraries' appears in the Linux terminal

To make the YASARA executable small, it is dynamically linked to a number of libraries that are normally installed in every Linux distribution since 2000. If you encounter the problem, please contact support@yasara.org and provide details about your Linux distribution, as well as the output of this command:


ldd ./yasara

We will then quickly send you a new download link that solves the problem.

Alternatively, you can install the missing library yourself, assuming that you know the root password on your machine or your system administrator allows 'sudo' access to package installation.

A special case are 64bit Linux distributions (AMD64): especially (K)Ubuntu normally comes without backwards compatible support for 32bit applications, look here for a solution .