Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'Charge<=>X' selects units by their charge

The Charge selection operator sums up the net charge of each unit (depending the current selection type) and selects those units that pass the comparison. If a force field has been initialized, the force field charge is used, otherwise YASARA resorts to the formal charge calculated from bond orders and standard atom valences.

Examples:
ListAtom Charge<0
List all atoms with a negative charge
ColorRes Charge!=0,red
Color all charged residues red
ListRes Asp Glu Charge=0
List all aspartates and glutamates that are neutral
ColorObj Charge>0,yellow
Color all objects with a positive net charge yellow