Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'AltLoc' switches to a selection of alternate conformations

Sometimes a bunch of atoms (mostly side-chains) can be seen at two or more distinct locations in the X-ray density map. These atoms are then present multiple times in the PDB file, but with different 'alternate location (AltLoc) indicators'. The 'AltLoc' selection type allows to choose one of these multiple conformations.

Examples:
DelAtom AltLoc B
Delete all atoms with an alternate location indicator 'B'
DelAtom AltLoc B-Z
Delete all atoms with AltLoc indicators B to Z