Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

pKaRes

-

Set/get residue pKa


CommandArgument DatatypeDefaultMinMax
Format:pKaResResidue selection, SELECTION---
  value = new residue pKa value FLOAT---
Python:pKaRes(selection1,value)
resultlist = pKaRes(selection1)
Menu:Options > Residue pKa
Related:pH
Required:


The pKaRes command sets or gets the pKas of the selected residues.

The pKas set by pKaRes replace those predicted by YASARA during the neutralization experiment . When pKas of important (active site) residues have been measured experimentally, it is recommended to specify them with pKaRes before setting up a simulation. This ensures that the protonation states assigned by YASARA correctly reflect the chosen pH.

When no new pKa is set, the pKaRes command returns the currently set pKa or -1 of no pKa has been assigned to a given residue before. pKaRes does not predict pKa values by itself.

The pKa assignments are properties attached to the first atom in a residue, hence they are saved with SaveSce and SaveYOb.

Example 1:
pKaRes His 70,value=2.5

Set the pKa of residue His 70 to 2.5 and consider this value during the next neutralization experiment.


Example 2:
pKaRes Obj 5,value=None

Delete all pKa assignments in object 5.


Example 3:
pka = pKaRes Asp 80

Get the previously set pKa value of residue Asp 80 and assign it to variable 'pka'.