Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

pH

-

Set/get default pH


CommandArgument DatatypeDefaultMinMax
Format:pHValue = Default pH value,FLOAT - --
  update = Yes | NoSTRINGYes--
Python:pH(value,update)
result = pH()
Menu:Options > Default pH
Related: pKaRes , TypeBond, AddHyd , AddBond, Experiment
Required:


The pH command sets the default pH considered when assigning bond orders or adding missing hydrogen atoms . It additionally enables (pH!=None) or disables (pH==None) the use of the COSMO implicit solvent model for quantum chemistry calculations.

If the Update parameter is set to 'yes', bonds will be retyped and hydrogens will be readded to match the new pH.

Typical examples include Asp and Glu side-chains, which are neutral at low pH <3-4, the Cys side-chain, which loses a proton at high pH (>8), or phosphoric acid, which is neutral (H3PO4) below pH 2, H2PO4- from pH 2 to 7, HPO4-- from pH 7 to 13 and PO4--- above.

If the pH is set to 'None', YASARA ignores the solvent effects and assumes neutral compounds, e.g. acids carry all their protons.

YASARA's knowledge about the pH dependence of bond orders and protonation patterns comes from the file yasara.def (present in YASARA Dynamics and above), which are described in more detail here . All assignments use experimentally determined standard pKa values, pKa shifts caused by the structural environment are not considered and handled separately for amino acids by the neutralization experiment.

Example 1:
pH 7.0

Set the default pH to 7.0 and update all bond orders and hydrogens.


Example 2:
pH 4.5,update=No

Set the default pH to 4.5, but do not update existing bond orders and hydrogens.


Example 3:
pH None

Disable the pH model and work in vacuo.


Example 4:
pH

Get the current pH.



Example macro:

# EXAMPLE pH
# Requires YASARA Model
Clear
# Color by bond order
ColorBonds Order
for ph=0 to 14
  # Set pH, but do not update existing molecules
  pH (ph),update=No
  # Load and position a collection of small molecules
  obj=LoadYOb phscan
  # Type the bonds and add hydrogens according to current pH
  TypeBond Obj (obj),Obj (obj)
  AddHydObj (obj)
  # Place the object
  y=6*(7-ph)
  PosObj (obj),0,(y),23
  # Display current pH
  obj=MakeTextObj Name=pH(ph),Width=8,Height=2
  Font Times,Height=2,Color=ff(00+ph*7)(00+ph*7),Depth=1.0,DepthCol=303030
  PosText 0%,0%,Left
  Print pH(ph)
  PosObj (obj),-18,(y),23
# Let the molecules move by
Pos -5,-60,26
AutoMove Y=0.1
Wait 500
AutoMove Y=0
HUD Off

Figure: Result of the example macro above.