Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'Killed' or 'Segmentation fault' appears in the Linux terminal

This message indicates that the operating system decided to kill YASARA instead of running it. The most likely reason is that you do not have enough RAM to run YASARA without exhausting your swap space and freezing your system. Your computer needs to have 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

To check your configuration, open a terminal and type

free

The output should look roughly like this one:

             total       used       free     shared    buffers     cached
Mem:        255240(a)  239944      15296          0      11332     112944
-/+ buffers/cache:     115668     139572
Swap:       522072(b)     252     521820

To run YASARA, the number marked (a) should be >120000, while (b) should be >250000. For the Twinset, (a) should be >500000 and (b) should be >1000000.

If you meet these requirements and still get killed, edit the file yasara.ini and change the 'Memory' field like that:

Memory 48

If that works, you can subsequently assign larger amounts of memory to YASARA.

If it still does not work, type


ulimit -a

and check that all memory options are set to 'unlimited':

max locked memory     (kbytes, -l) unlimited
max memory size       (kbytes, -m) unlimited
virtual memory        (kbytes, -v) unlimited

If this is not the case, set them to unlimited:

ulimit -l unlimited
ulimit -m unlimited
ulimit -v unlimited

Some of this changes may only be made by user 'root'. To make them permanent, you have to edit the file /etc/security/limits.conf and add the lines

* hard memlock unlimited
* soft memlock unlimited
* hard rss unlimited
* soft rss unlimited
* hard data unlimited
* soft data unlimited

And afterwards reboot the machine.