Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Getting started

° 

The ten magic words


° 

Atom

-

YASARA's representation of a true atom

° 

Residue

-

any continuous stretch of atoms sharing the same residue name, residue number and molecule name

° 

Molecule

-

any continuous stretch of residues sharing the same molecule name

° 

Object

-

a collection of molecules and additional items

° 

Soup

-

all atoms in active objects

° 

Scene

-

all objects together

° 

All

-

the scene or the soup

° 

Bond

-

a covalent link between two atoms with pH dependent order

° 

Local coordinate system - The coordinate system within one object

° 

Global coordinate system - The coordinate system of the scene

° 

The three potential pitfalls


° 

You never get less than you want

° 

There is a difference between 'Hide', 'Switch off', 'Remove' and 'Delete'

° 

Gaps in a molecule are bridged by default

° 

The keys and mouse buttons to use


° 

Moving objects around

° 

Changing the scene style

° 

Editing

° 

Analyzing the soup

° 

Controlling a simulation

° 

Using the console

° 

Other keys

° 

The command line parameters

° 

Running YASARA in special environments


° 

Running YASARA without graphics

° 

Running YASARA on one machine with multiple users

° 

Running YASARA from an NFS mounted volume

° 

Running YASARA on a 64 bit operating system

° 

Working with extremely large protein structures

° 

Citing YASARA, its algorithms and force fields

° 

Reporting bugs, problems and inconveniences

° 

Screenshots as examples of what you can do


° 

Selections

-

Tell YASARA what you want


° 

Selections are defined by a final type and an expression

° 

Possible final selection types are All, Obj, Mol, Res and Atom

° 

Ranges can be specified with a minus sign

° 

A logical OR is assumed between items of the same selection type

° 

A logical AND is assumed if you switch the selection type

° 

Selections are inflated to the final selection type at the end

° 

Additional selection types allow to filter for various properties


° 

'Element' switches to a selection of chemical elements

° 

'SecStr' switches to a selection of secondary structure types

° 

'Segment' switches to a selection of macromolecular segments

° 

'AltLoc' switches to a selection of alternate conformations

° 

'Protein', 'NucAcid' and 'HetGroup' immediately select proteins, nucleic acids and the rest

° 

'Backbone', 'Sidechain' and 'Visible' immediately select backbone, side-chain and visible atoms

° 

'PDB', 'PDBRev', 'YASARA', 'IUPAC' and 'XPLOR' change the atom naming scheme

° 

'LocalX|Y|Z<>X' and 'GlobalX|Y|Z<>X' select atoms by their position

° 

'BFactor<>X', 'Occupancy<>X' and 'Property<>X' select atoms by B-factor, occupancy and property value

° 

'Charge<=>X' selects units by their charge

° 

Names can be negated with an exclamation mark '!'

° 

Names can be wildcards using a question mark '?'

° 

Names with unusual characters can be quoted

° 

Selections can be combined with explicit operators


° 

The 'and', 'or' and 'not' operators perform logical operations

° 

The 'with distance <>X from' operator measures distances between atoms

° 

The 'with minimum distance from' operator finds the closest atom

° 

The 'with maximum distance from' operator finds the most distant atom

° 

The 'with <>X atoms closer Y among' operator counts close atoms

° 

The 'with <>X bonds to' operator analyzes bound atoms

° 

The 'with <>X bond angles to' operator analyzes second neighbor atoms

° 

The 'with distance <>X from Y surface...' operator measures distances from a surface

° 

The 'with contribution to X surface...' operator analyzes surface contributions

° 

The 'within sequence' operator selects within a given sequence

° 

Selections are not case sensitive except for two special cases

° 

Selection windows allow to build selections with the mouse

° 

Yanaconda helps to define selection subsets

° 

Examples of selections needed in real-life


° 

Commands

-

Tell YASARA what to do


° 

File

-

Load and save the scene or parts of it


° 

New scene - Start again

° 

PDB files - Load and save objects in plain PDB format

° 

YASARA objects - Load and save complete objects

° 

YASARA scenes - Load and save the entire scene

° 

OpenBabel

-

Import and export molecules using OpenBabel

° 

Screenshots

-

Save plain or ray-traced screenshots

° 

MPEG movies - Encode plain or ray-traced animations

° 

Simulation snapshots - Load and save simulation states

° 

Exit

-

Quit YASARA

° 

Edit

-

Change content and properties of the soup


° 

History

-

Undo and redo changes

° 

Objects

-

Center, transform, transfer, remove, add and delete

° 

Split points - Edit split points, split and join entire objects

° 

Bonds

-

Add, type and delete bonds

° 

Building

-

Build atoms to molecules, oligomers, crystals and loops

° 

Geometry

-

Set or optimize distances, angles and dihedrals

° 

Sampling

-

Search conformational space

° 

Surface environments - Define the context of surface analysis

° 

Hydrogens

-

Add, swap and delete

° 

Water

-

Delete all waters

° 

Names and numbers - Set or get properties of atoms to objects

° 

Simulation

-

Simulate the soup


° 

Preparing a simulation - Define and fill the cell

° 

Force fields - Get the recipe

° 

Simulation parameters - Choose your favorite ingredients

° 

Restraints

-

Enforce distances and dihedral angles

° 

Running a simulation - Keep the soup from boiling

° 

Analyze

-

Analyze the soup


° 

Atom position - Calculate average positions and RMSFs

° 

Superposition

-

Align atoms and calculate RMSDs

° 

Contacts

-

List contacts and hydrogen bonds

° 

Energy

-

Calculate energies

° 

Electrostatics

-

Calculate electrostatic potentials and charges

° 

Geometry

-

Measure distances, angles, dihedrals and radii

° 

Rotamers

-

Show rotamer distributions

° 

Secondary structure - Calculate secondary structure content

° 

Surface areas - Calculate VdW, molecular and accessible surfaces

° 

Volumes

-

Calculate VdW, molecular and solvent accessible volumes

° 

Soup content - List, count and compare units, get boundaries

° 

Checks

-

Search for errors

° 

View

-

Change the appearance of the soup


° 

Colors

-

Add a fourth dimension to your figures

° 

Visibility

-

Show and hide, switch on and off

° 

Style

-

Display atoms as balls, balls&sticks, sticks and traces

° 

Secondary structure - Show tubes, ribbons and cartoons

° 

Surfaces

-

Show VdW, molecular and solvent accessible surfaces

° 

Hydrogen bonds - Show hydrogen bonds

° 

Atoms

-

Choose atom styles

° 

Projection

-

Switch the perspective

° 

Lighting

-

Light the scene

° 

Effects

-

Change and animate the scene


° 

Position

-

Place and move objects

° 

Orientation

-

Orient and rotate objects

° 

Labels

-

Display text labels

° 

Marks and zooms - Mark atoms with fireflies and zoom in

° 

Arrows

-

Show arrows connecting atoms or points

° 

Solids

-

Show spheres, boxes, pyramids, cylinders, tori and others

° 

Images

-

Show and animate bitmaps

° 

Text

-

Print text, possibly in 3D letters

° 

Options

-

Other commands


° 

Experiments

-

Let YASARA cook for you

° 

Macros

-

Watch YASARA do the work for you

° 

Tables

-

Collect, visualize and export data

° 

Formats

-

Choose the residue output format

° 

Logs

-

Redirect output to a file

° 

Plugins

-

Run plugins from a macro

° 

Default pH - Set the H+ ion concentration and residue pKas

° 

Quantum mechanics - Configure YAPAC

° 

Coordinate system - Live in a left or right handed world

° 

Units

-

Choose your favorite units

° 

Parallel computations - Configure multi CPU core usage

° 

Input devices - Configure the interaction with YASARA

° 

Shell

-

Execute shell commands

° 

Window

-

Change the display properties


° 

Location

-

Place the YASARA window

° 

Menus

-

Change the appearance of menus

° 

Console

-

Configure the console

° 

Antialiasing

-

Smooth is better

° 

Frequency

-

Change the frames per second and save battery power

° 

Stereo

-

Time to touch your molecules

° 

Help

-

Access the documentation and solve problems


° 

Manual

-

Browse the HTML documentation

° 

Installation

-

Download missing programs

° 

Index

-

All commands in alphabetic order


° 

Recipes

-

Answer complex questions


° 

Run molecular dynamics simulations


° 

Preparing the topology

° 

Preparing the force field

° 

Running a simulation

° 

Analyzing a trajectory

° 

Playing back a trajectory

° 

Refine a homology model


° 

The quick method: in vacuo energy minimization with the NOVA force field

° 

The slow method: explicit solvent molecular dynamics simulation with the YAMBER force field

° 

Solve an NMR structure


° 

Setting the parameters

° 

Folding the structure

° 

Refining the structure in vacuo

° 

Refining the structure in explicit solvent

° 

Analyzing the ensemble

° 

Handling special cases like Cys-bridges, oligomers and metalloproteins

° 

Avoiding problems with hydrogen nomenclature

° 

Making floating assignments

° 

Create your own YASARA Movies


° 

Movies are written in Yanaconda

° 

Movies are stored in the yasara/mov directory

° 

Movies start with typical commands

° 

Movies can wait for a specified time or until you press a button

° 

Labels allow to jump back and forth between movie sections

° 

Work with YASARA and your text editor in parallel

° 

Movies can be imported from OpenOffice or PowerPoint

° 

Bitmap images can be displayed and animated

° 

Text can be displayed using 3D letters

° 

The look of the movie depends on the aspect ratio of the YASARA window

° 

Hints for using movies in important presentations


° 

Macros

-

Automate your work with Yanaconda


° 

Macros can be recorded or written manually

° 

Yanaconda is Yet ANother Abridged COding 'N' Development Approach

° 

Yanaconda is a reinterpreted language

° 

Explicit evaluators modify the source code at run time

° 

When writing Yanaconda macros, use Python syntax highlighting

° 

The four datatypes are integer, float, weak string and strong string


° 

Integers remember the number of leading zeroes

° 

Floats remember their precision

° 

Weak strings are enclosed by single quotes

° 

Strong strings are enclosed by double quotes

° 

The left operand defines the datatype of the result

° 

Yanaconda supports the usual operators


° 

The negation operator has the maximum priority 7: !, not

° 

Operators with priority 6: *, /, //, %, <<, >>

° 

Operators with priority 5: +, -

° 

Operators with priority 4: &, |, ^

° 

Operators with priority 3: >, >=, <=, <, ==, !=

° 

Operators with priority 2: in

° 

Operators with minimum priority 1: and, or

° 

Indentation defines the program flow and must be a multiple of two spaces

° 

Control the program flow with if, elif and else

° 

There are four types of loops


° 

Loops can run over a range of numbers: for i = X to Y step Z

° 

Loops can run over a list: for i in X,Y,Z,..

° 

Loops can run while an expression is true: while X and do .. while X

° 

Stop a loop with 'break'

° 

Loop ahead with 'continue'

° 

Lists are emulated with explicit evaluators


° 

Matrices are two dimensional lists

° 

The 'count' function determines the length of lists

° 

The 'min', 'max', 'sum', 'mean', 'stddev' and 'join' functions return the smallest, largest, sum, mean, standard deviation and concatenation of all list elements

° 

Lists can be sorted

° 

Yanaconda macros can access predefined variables

° 

Yanaconda macros can include each other

° 

Calls to built in functions can be placed anywhere within an expression

° 

Calls to YASARA commands must appear one per line

° 

Macros can be speeded up by switching off the console


° 

Plugins

-

Extend YASARA with your own functions


° 

Plugins allow you to add your own menu options

° 

Plugins can be written in Yanaconda or Python

° 

Python can be downloaded from www.python.org

° 

Plugins must stick to format conventions


° 

The header identifies a plugin

° 

The menu structure is enclosed in a triple-quote comment

° 

The layout for the remaining plugin differs between Python and Yanaconda

° 

Plugins can access most YASARA functions

° 

Python plugins can access a number of predefined variables


° 

Object descriptors identify selected objects

° 

Molecule descriptors identify selected molecules

° 

Residue descriptors identify selected residues

° 

Atom descriptors identify selected atoms

° 

Python plugins run in a separate thread

° 

Plugins can be speeded up by switching off the console

° 

Plugins can be run from the command line and in console mode

° 

Debugging is done by adding temporary print commands


° 

Scripts

-

Use YASARA as a Python module


° 

Windows users can obtain Python from www.python.org

° 

Copy and import yasara/pym/yasara.py

° 

There is a Python function wrapper for most YASARA commands

° 

Python functions return either nothing, a single value or a list

° 

YASARA specific data is available in 'info'

° 

YASARA commands with multiple formats map to different Python functions

° 

A subset of the YASARA soup can be obtained as a pdb_file instance

° 

The console needs to be switched off for maximum performance

° 

There is a specific Python function for each experiment

° 

The Python module can run YASARA in graphics or text mode


° 

Troubleshooting

-

Get things going


° 

Known inconveniences

° 

YASARA cannot be installed


° 

The message './install_yasara: No such file or directory' appears in the Linux terminal

° 

YASARA does not start


° 

YASARA does not start from CD

° 

You are using Windows and nothing happens when you start YASARA

° 

A message about /dev/nvidiactl permission problems appears in the Linux terminal

° 

'Killed' or 'Segmentation fault' appears in the Linux terminal

° 

'Error while loading shared libraries' appears in the Linux terminal

° 

A red box appears: Error 2 - Essential videomode not supported under Linux

° 

A red box appears: Error 53 or 353 - No vector registers available or wrong CPU architecture

° 

A red box appears: Error 93 - Center of YASARA window off screen

° 

The YASARA windows stays empty and black in Linux

° 

YASARA displays an error-like message in the terminal


° 

The message '*** Assertion failure in -[NSEvent deviceDeltaX]' appears in the terminal

° 

The message 'Disabled smooth atom colors' appears in the terminal

° 

The message 'disabling TCL support' appears in the terminal

° 

The message 'libgcc_s.so.1 must be installed for pthread_cancel to work' appears in the terminal

° 

The message 'libGL warning: 3D driver claims to not support visual 0x4b' appears in the terminal

° 

The message 'Mesa X.Y.Z implementation error' appears in the terminal

° 

The message 'XFree86-DRI missing' appears in the terminal

° 

YASARA gets stuck in the startup screen

° 

YASARA displays a warning at the bottom of the startup screen


° 

Warning

-

Python not found

° 

Warning

-

Screen update not synchronized

° 

YASARA crashes right after the startup screen

° 

Something is wrong with the user interface


° 

YASARA crashes completely when you activate a menu

° 

It takes too long till the menu appears

° 

When the menu appears, the colors turn crazy

° 

Some menu entries are missing

° 

The mouse pointer disappears or flickers

° 

Some keys do not work as expected

° 

The Spaceball 3D controller does not work as expected

° 

YASARA runs slowly or displays incorrect graphics


° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

° 

You are running Windows Vista

° 

You are running Windows with an nVIDIA card

° 

You are running Windows with an ATI Radeon card

° 

You are running Linux with an nVIDIA card

° 

You are running Linux with an ATI Radeon card

° 

You are running Linux with a Xig graphics driver

° 

You are using a notebook

° 

You have an Intel 82845G graphics chip

° 

You have an Intel 82865G graphics chip

° 

You have an Intel 82915G graphics chip

° 

You have an S3 graphics chip

° 

You have a SiS M650 graphics chip

° 

You have a 3DLabs Wildcat card

° 

YASARA shows strange CPU usage patterns or crashes on dual core CPUs or dual CPU systems

° 

Something is wrong with your molecule


° 

You used OpenBabel ('other Fileformat') to read/write the molecule

° 

YASARA does not behave as expected with two or more connected monitors

° 

Quad-buffered stereo cannot be activated or flickers.

° 

YASARA fails to run Python plugins or other programs like PovRay, OpenBabel, MSMS

° 

YASARA or the entire computer freezes


° 

YASARA hangs, but other programs are not affected

° 

The computer freezes when you minimize the YASARA window

° 

The computer freezes when you start YASARA a second time

° 

YASARA quits with a red error box or crashes sometime later

° 

The Twinset encounters a technical problem

° 

Forwarding the YASARA window via SSH does not work