Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Getting started

° 

The ten magic words

° 

The three potential pitfalls

° 

The keys and mouse buttons to use

° 

The command line parameters

° 

Running YASARA in special environments

° 

Working with extremely large protein structures

° 

Citing YASARA, its algorithms and force fields

° 

Reporting bugs, problems and inconveniences

° 

Screenshots as examples of what you can do


° 

Selections

-

Tell YASARA what you want


° 

Selections are defined by a final type and an expression

° 

Possible final selection types are All, Obj, Mol, Res and Atom

° 

Ranges can be specified with a minus sign

° 

A logical OR is assumed between items of the same selection type

° 

A logical AND is assumed if you switch the selection type

° 

Selections are inflated to the final selection type at the end

° 

Additional selection types allow to filter for various properties

° 

Names can be negated with an exclamation mark '!'

° 

Names can be wildcards using a question mark '?'

° 

Names with unusual characters can be quoted

° 

Selections can be combined with explicit operators

° 

Selections are not case sensitive except for two special cases

° 

Selection windows allow to build selections with the mouse

° 

Yanaconda helps to define selection subsets

° 

Examples of selections needed in real-life


° 

Commands

-

Tell YASARA what to do


° 

File

-

Load and save the scene or parts of it

° 

Edit

-

Change content and properties of the soup

° 

Simulation

-

Simulate the soup

° 

Analyze

-

Analyze the soup

° 

View

-

Change the appearance of the soup

° 

Effects

-

Change and animate the scene

° 

Options

-

Other commands

° 

Window

-

Change the display properties

° 

Help

-

Access the documentation and solve problems

° 

Index

-

All commands in alphabetic order


° 

Recipes

-

Answer complex questions


° 

Run molecular dynamics simulations

° 

Refine a homology model

° 

Solve an NMR structure

° 

Create your own YASARA Movies


° 

Macros

-

Automate your work with Yanaconda


° 

Macros can be recorded or written manually

° 

Yanaconda is Yet ANother Abridged COding 'N' Development Approach

° 

Yanaconda is a reinterpreted language

° 

Explicit evaluators modify the source code at run time

° 

When writing Yanaconda macros, use Python syntax highlighting

° 

The four datatypes are integer, float, weak string and strong string

° 

The left operand defines the datatype of the result

° 

Yanaconda supports the usual operators

° 

Indentation defines the program flow and must be a multiple of two spaces

° 

Control the program flow with if, elif and else

° 

There are four types of loops

° 

Lists are emulated with explicit evaluators

° 

Yanaconda macros can access predefined variables

° 

Yanaconda macros can include each other

° 

Calls to built in functions can be placed anywhere within an expression

° 

Calls to YASARA commands must appear one per line

° 

Macros can be speeded up by switching off the console


° 

Plugins

-

Extend YASARA with your own functions


° 

Plugins allow you to add your own menu options

° 

Plugins can be written in Yanaconda or Python

° 

Python can be downloaded from www.python.org

° 

Plugins must stick to format conventions

° 

Plugins can access most YASARA functions

° 

Python plugins can access a number of predefined variables

° 

Python plugins run in a separate thread

° 

Plugins can be speeded up by switching off the console

° 

Plugins can be run from the command line and in console mode

° 

Debugging is done by adding temporary print commands


° 

Scripts

-

Use YASARA as a Python module


° 

Windows users can obtain Python from www.python.org

° 

Copy and import yasara/pym/yasara.py

° 

There is a Python function wrapper for most YASARA commands

° 

Python functions return either nothing, a single value or a list

° 

YASARA specific data is available in 'info'

° 

YASARA commands with multiple formats map to different Python functions

° 

A subset of the YASARA soup can be obtained as a pdb_file instance

° 

The console needs to be switched off for maximum performance

° 

There is a specific Python function for each experiment

° 

The Python module can run YASARA in graphics or text mode


° 

Troubleshooting

-

Get things going


° 

Known inconveniences

° 

YASARA cannot be installed

° 

YASARA does not start

° 

YASARA displays an error-like message in the terminal

° 

YASARA gets stuck in the startup screen

° 

YASARA displays a warning at the bottom of the startup screen

° 

YASARA crashes right after the startup screen

° 

Something is wrong with the user interface

° 

YASARA runs slowly or displays incorrect graphics

° 

YASARA shows strange CPU usage patterns or crashes on dual core CPUs or dual CPU systems

° 

Something is wrong with your molecule

° 

YASARA does not behave as expected with two or more connected monitors

° 

Quad-buffered stereo cannot be activated or flickers.

° 

YASARA fails to run Python plugins or other programs like PovRay, OpenBabel, MSMS

° 

YASARA or the entire computer freezes

° 

YASARA quits with a red error box or crashes sometime later

° 

The Twinset encounters a technical problem

° 

Forwarding the YASARA window via SSH does not work