Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'LocalX|Y|Z<>X' and 'GlobalX|Y|Z<>X' select atoms by their position

Sometimes it is helpful to select atoms by their position, for example to slice a protein open and show only the back half. In YASARA, every atom has actually two positions, first the position in the local coordinate system of the object (which is specified in the PDB file), and second the position in the global coordinate system of the screen. Like those in the previous sections, the operators described here perform an implicit logical 'and'.

Examples:
HideAtom localX<0
Hide atoms with an X-position < 0 in the local coordinate system
ShowAtom localY>5 localZ<-10
Show atoms with a local Y-position > 5 and a local Z-position < -10
HideAtom globalY<0
Hide atoms with a Y-position < 0 in the global coordinate system
HideAtom globalX>0
Hide atoms in the right half of the screen