Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'Protein', 'NucAcid' and 'HetGroup' immediately select proteins, nucleic acids and the rest

Contrary to the previous selection types, these three do not require an actual selection afterwards. That's why they leave the selection type unaltered, nevertheless they perform an implicit logical AND like all the others above.

Examples:
DelMol NucAcid
Delete all nucleic acid molecules
DelAtom CA CB Protein
Delete all atoms named CA or CB and belonging to a protein
DelRes HetGroup
Delete everything that is neither a protein nor a nucleic acid