Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'Backbone', 'Sidechain' and 'Visible' immediately select backbone, side-chain and visible atoms

Everthing said for 'Protein', 'NucAcid' and 'HetGroup' also applies to these three. Note that the 'visible' selector looks at the atom visibilities set with Show and Hide , not at the object visibilities set with Switch .

Examples:
ColorAtom Sidechain,Blue
Color all side-chain atoms blue
ColorAtom Res Glu Asp Backbone,Red
Color the backbone of Glu or Asp residues red
DelRes Sidechain
Delete all residues with a side-chain (no glycines)
ShowSurfAtom O Res HOH visible,VdW
Show a Van der Waals surface for all visible water oxygens
DelAtom !visible
Delete all invisible atoms