Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

'PDB', 'PDBRev', 'YASARA', 'IUPAC' and 'XPLOR' change the atom naming scheme

Over the last decades, slightly different atom naming schemes have been introduced. For example YASARA and XPLOR name the terminal oxygens OT1 and OT2 to indicate their chemical equivalence, while the PDB prefers O and OXT, and IUPAC suggests O' and O''. If you are working in NMR spectroscopy, you are also used to the many problems associated with hydrogen nomenclature, which are described in more detail here.

The operators described here allow to change the current naming scheme when selecting atoms. The new scheme stays valid until the next change or the next explicit operator. In the latter case, it is changed back to YASARA's own default names.

Examples:
ColorAtom PDB 1HB,blue
Color the first of all equivalent beta-hydrogens blue
ColorAtom XPLOR HB2,yellow
Color all atoms whose XPLOR name is HB2 yellow
DelAtom IUPAC HG3 PDB 1HB
Delete atoms whose IUPAC name is HG3 plus those whose PDB name is 1HB
DelAtom PDB OXT
Delete all terminal oxygens
ListAtom PDB 1HG and XPLOR HG2
List the first of all gamma-methylene hydrogen pairs