Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Zoom<Atom|Res|Mol|Obj|All>

-

Zoom in on atoms


CommandArgument DatatypeDefaultMinMax
Format:Zoom<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Steps = Number of steps to complete zoom in update cycles, INT100- -
   Wait = Wait for completion of zoom Yes | NoSTRINGYes--
Python:Zoom<Atom|Res|Mol|Obj|All>(selection1,steps=None,wait=None)
Menu:Edit > Effects > Zoom in on
Related:Label, MarkAtom
Required:


The Zoom command changes the view of the scene to bring the selected atoms onto the screen.

If the 'Atom' command extension is chosen and exactly one atom is selected, the scene will be moved and rotated so that this atom ends up in the center of the screen. In all other cases, the scene will be moved (but not rotated) so that the selected atoms fit nicely on the screen.

If you set 'steps' to 0, the zoom will be done immediately, otherwise a Wait command may be required to wait until the zoom is completed. When running YASARA in console mode, 'steps' must always be 0.

All selected atoms will be zoomed onto the screen, no matter if they are visible or not. When showing only a ribbon, it may therefore help to zoom only the backbone atoms.

Example 1:
ZoomAtom CA Res 17,2000

Zoom in on the CA atom of residue 17 in 2000 steps and wait until the zoom is completed.


Example 2:
ZoomObj 1

Fit object 1 to the screen immediately.


Example 3:
ZoomObj 5,Steps=1000,Wait=No

Move the camera in 1000 steps so that object 5 covers the screen, but do not wait until the zoom is completed.


Example 4:
ZoomAtom Backbone Obj 1crn,Steps=0

Zoom in on the backbone atoms of object 1crn immediately.