Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going


° 

Known inconveniences

° 

YASARA cannot be installed

° 

YASARA does not start

° 

YASARA displays an error-like message in the terminal

° 

YASARA gets stuck in the startup screen

° 

YASARA displays a warning at the bottom of the startup screen

° 

YASARA crashes right after the startup screen

° 

Something is wrong with the user interface

° 

YASARA runs slowly or displays incorrect graphics


° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

° 

You are running Windows Vista

° 

You are running Windows with an nVIDIA card

° 

You are running Windows with an ATI Radeon card

° 

You are running Linux with an nVIDIA card

° 

You are running Linux with an ATI Radeon card

° 

You are running Linux with a Xig graphics driver

° 

You are using a notebook

° 

You have an Intel 82845G graphics chip

° 

You have an Intel 82865G graphics chip

° 

You have an Intel 82915G graphics chip

° 

You have an S3 graphics chip

° 

You have a SiS M650 graphics chip

° 

You have a 3DLabs Wildcat card

° 

YASARA shows strange CPU usage patterns or crashes on dual core CPUs or dual CPU systems

° 

Something is wrong with your molecule

° 

YASARA does not behave as expected with two or more connected monitors

° 

Quad-buffered stereo cannot be activated or flickers.

° 

YASARA fails to run Python plugins or other programs like PovRay, OpenBabel, MSMS

° 

YASARA or the entire computer freezes

° 

YASARA quits with a red error box or crashes sometime later

° 

The Twinset encounters a technical problem

° 

Forwarding the YASARA window via SSH does not work