Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA runs slowly or displays incorrect graphics

If YASARA responds very slowly, this can have a couple of different reasons. A trivial cause may be that your 'FramesPerSecond' setting is too low: Click Window > Update frequency and set it to a high number, e.g. 75.

° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

If you are running Windows 95 to XP, click on Start > Control Panel > Display > Settings > Advanced > maybe 'Adapter' or 'Options', depends on your card. In Windows NT, the usual location is Start > Settings > Control Panel > Display > Settings > Display type. Somewhere around there, you should find the name of your graphics card and the driver version (e.g. a list of *.dll files).

In Windows Vista, click Start > Control panel > Classic View > Device Manager > Display adapters. Double-click on your display adapter, then click 'Driver'.

In Linux, open a terminal and type
glxinfo
to display information about your OpenGL driver.

If you purchased your graphics card before 2000, it may be a problem to run YASARA at a usable speed. The reason is usually not that the graphics card is too weak, but that there is not enough video memory and the driver switches back to software rendering. Nevertheless, YASARA runs OK on a Matrox G400 with 16MB ram. First edit the file yasara.ini and set VisualQual to 0, then reduce your screen color depth to 16 bits (65536 colors), and the screen resolution to <=1024x768. If this helps, try subsequently higher resolutions. If you have less than 16MB ram on your video card, it's probably best to just get a new one.

Examples of cards that are just too old for YASARA:
  • ATI Mach, Rage IIC, Rage XL, Rage XC
  • All 3DFX Voodoo cards
  • Matrox Mystique

° 

You are running Windows Vista

Microsoft unfortunately ships graphics drivers with reduced functionality, which support only very slow OpenGL software rendering and leave the power of your graphics card unused, except for the transparent Aero glass windows and video games.

Click Start > Control panel > Classic View > Device Manager > Display adapters to determine the manufacturer of your graphics chip. Double-click on your display adapter, then click 'Driver' to find your graphics driver version.

Known issues:

  • nVIDIA drivers 7.14.10.9677 and older are known not to accelerate graphics, downloading the latest Windows Vista driver from www.nvidia.com solves the problem. The new driver version should be 9.6.8.5 or higher.

  • Windows Vista is currently (2006/12/01) not well suited for running graphics intensive scientific applications like YASARA. Even with the latest nVIDIA drivers, the performance is only ~30% of what you get in Linux or Windows XP on the same machine. Try to avoid Windows Vista until Microsoft has solved the technical problems.

° 

You are running Windows with an nVIDIA card

In this case it is most likely a driver issue . During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers like..

nvopengl.dll 4.13.01.3082

In this nVIDIA example, 3082 is the driver version.

  • The original Microsoft drivers shipping with Windows XP are bugged and can cause YASARA to crash. Please download the latest driver from www.nvidia.com.

  • nVIDIA Geforce driver versions 3082 and earlier cannot run YASARA properly, installing new drivers (at least version 4523) solves the problem.

  • nVIDIA Quadro drivers around version 6693 have a bug that makes the YASARA console at the bottom of the window invisible. Updating to at least version 7184 solves the problem.

° 

You are running Windows with an ATI Radeon card

In this case it is most likely a driver issue. During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers.

  • ATI driver version 6.14.10.6542 from 2005 was reported to show completely corrupted graphics on a dual core machine with an ATI Radeon X600 PRO card. Updating the Radeon driver to Catalyst 6.6 solved the problem.

  • ATI Catalyst 6.11 from 2006 with OpenGL driver 6.14.10.5819 was reported to show colorless ribbons and cartoons or even crash on an ATI Radeon 7000 card with 32MB video ram and two connected monitors. Closer inspection showed that the driver couldn't cope with the exhausted video ram. The problem could be solved by not expanding the desktop over both monitors.

° 

You are running Linux with an nVIDIA card

nVIDIA does not allow Linux distributors to include their Geforce drivers. So a freshly installed Linux will run terribly slow with OpenGL applications, including YASARA. (Non-OpenGL programs like Rasmol will work fine however, that's why you may not have noticed it.)

Open a terminal and type

glxinfo | grep vendor

If the output does not show 'nVIDIA corporation' but 'SGI' and 'www.mesa3d.org', you DO NOT have an accelerated OpenGL installation and cannot use the power of your Geforce card.

To best way to install the required drivers depends on your Linux distribution. It is likely that your distribution offers prebuilt packages, which you can simply install with your package manager.

For (K)Ubuntu, the usual sequence of commands (after enabling the universe and multiverse repositories) is:

sudo apt-get update
sudo apt-get install nvidia-glx
sudo dpkg-reconfigure xserver.org (select 'nvidia' from the list)

Edit the file /etc/X11/xorg.conf, and follow the instructions below regarding dri and nvidia. The press <Ctrl>+<Alt>+<Backspace> to restart the X-server. If 'glxinfo | grep vendor' now displays nVIDIA, you are ready to go.

Fedora Core 5 is broken with respect to the official nVIDIA drivers. A solution is provided at http://www.fedorafaq.org/#nvidia. Even with this recipe, we got one or two reports of unexpected nVIDIA problems on Fedora Core 5.

If there are no prebuilt packages for your distribution , go to www.nvidia.com and download their latest Linux driver. They also provide detailed installation instructions. Note that you need the root password to install.

The probably most important thing when installing is that your X-server is not running. Press <Ctrl>+<Alt>+<F2> to switch to a text screen, log in as root and type
/sbin/init 3

Usually you type
sh ./NVIDIA-Linux-x86-1.0-[DriverVersion].run
to install (for SuSE Linux, add the parameter -q).

If this fails, you have to look in the file /var/log/nvidia-installer.log

After installing, you can find detailed instructions on how to proceed in the file
/usr/share/doc/NVIDIA_GLX-1.0/README

It is especially important to adapt the file /etc/X11/XF86Config or /etc/X11/xorg.conf:

  • In the 'Device' section, replace the line
    Driver "nv"
    
    with
    Driver "nvidia"
    

  • In the 'Module' section, delete the lines
    Load "dri"
    
    and (if present)
    Load "GLcore"
    
    and make sure you have
    Load "glx"
    

Now type
init 5
to restart X.

If completed successfully, 'glxinfo' should show 'NVIDIA Corporation' as OpenGL vendor. You can now restart YASARA.

Additional hints:

  • SuSE distributes some 'special editions' of e.g. SuSE 9.0 on one CD. You often find these bundled with computer magazines. Before you can install the nVIDIA drivers on such a special edition, you need to download the following RPMs from the SuSE FTP server:
    
    kernel-source
    glibc-devel
    make
    gcc
    
    

  • SuSE Linux requires to run sax2 after installing the nVIDIA drivers:


sax2 -r -m 0=nvidia (0 is a digit, not a letter!)

  • The Linux Compiz window manager for advanced desktop 3D effects was once reported to make the sticks between atoms disappear as soon as a non-standard atom colors are chosen.

  • On a Fedore Core 1 installation, you may get a complaint about a "Failed cc sanity check", which should be taken seriously. Do not follow the possibility to set the 'IGNORE_CC_MISMATCH' flag, this causes serious graphics problems and can freeze your system. Instead download the latest nVIDIA driver to solve this issue.

° 

You are running Linux with an ATI Radeon card

When running OpenGL applications in Linux, you should buy a graphics card from nVIDIA, since they provide the best graphics drivers that cause the least number of problems. ATI Linux drivers tend to expose graphics bugs, are often impossible to install or do not support the latest chips. This has gotten better lately with the takeover by AMD.

If your computer already contains an ATI Radeon card, there is a resonable chance that everything works correctly if you follow these hints:

NOTE: If you successfully installed the Radeon drivers and YASARA's user interface still lags behind, scroll to the end of this section.

Most default Linux installations (e.g. RedHat, Fedora) do not activate hardware accelerated OpenGL graphics for newer Radeon cards. Instead, only the unusably slow Mesa software emulation is available.

Open a terminal and type

glxinfo

If the output indicates that your OpenGL vendor is 'Tungsten Graphics', then there is a good chance that YASARA works correctly, especially on older Radeon chips (on Radeon 9600, you may get a 'Mesa implementation error' however, which can be worked around by disabling shadow and lighting at View > Lighting):


OpenGL vendor string: Tungsten Graphics, Inc.
OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
OpenGL version string: 1.2 Mesa 4.0.4

On the other hand, if you find the following in the output, you do not have hardware accelerated 3D graphics activated, and using YASARA with this configuration is hopeless:


OpenGL vendor string: Mesa project: www.mesa3d.org
OpenGL renderer string: Mesa GLX Indirect
OpenGL version string: 1.3 Mesa 4.0.4

In latter case, you need to install the proper driver from ATI: click on www.ati.com and download the latest Linux Radeon driver.

Installation instructions for Fedora Core

At least in Fedora Core 5 and 6, the drivers available from the ATI web site cannot be installed. The Fedora project however provides customized drivers as RPM packages in the livna repository:

  • Become root
  • Add the Livna repository to yum:
    rpm -Uhv http://rpm.livna.org/livna-release-6.rpm
    
  • Install the ATI kernel module and OpenGL driver (you can leave out *-32bit on 32bit systems)
    
    yum install kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    yum update kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    
    
  • Configure the driver:
    
    service ati-fglrx restart
    ati-fglrx-config-display enable
    
    
  • If you did not disable SELinux during installation:
    
    setsebool -P allow_execstack=1
    setsebool -P allow_execmod=1
    
    
  • Make sure that the file /etc/X11/xorg.conf contains the following sections:


Section "Module"
  Load "dbe"
  Load "extmod"
  Load "fbdevhw"
  Load "glx"
  Load "record"
  Load "freetype"
  Load "type1"
  Load "dri"
EndSection

Section "Device"
  Identifier  "aticonfig-Device[0]"
  Driver      "fglrx"
  Option      "VideoOverlay" "on"
  # This enables VSYNC
  Option      "Capabilities" "0x00000800"
EndSection

Section "ServerFlags"
  Option "AIGLX" "False"
EndSection

Section "DRI"
  Group 0
  Mode 0666
EndSection

Section "Extensions"
  Option "Composite" "False"
EndSection

  • Restart the X-server.
  • Open a terminal and verify that 'glxinfo' displays:
    
    ...
    OpenGL vendor string: ATI Technologies Inc.
    ...
    
    

Installation instructions for other Linux distributions and the new *.run drivers (2005 and later)

In 2005, ATI introduced a new installer (usually a big file >50 MB) with the extension '.run'.

  • Check that you have the GCC compiler as well as the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. in RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs. In SuSE, click System > YaST. Now check that /usr/src/linux-[YourKernelVersion] is present.

  • Download the installer from the ATI website, e.g. ati-driver-installer-8.19.10-i386.run.

  • Become root

  • Check that your Linux distribution is supported:
    ./ati-driver-installer-8.19.10-i386.run --get-supported
    

Example output:

ATI/XFree86-4_1_X
ATI/XFree86-4_2_X
Debian/woody
Debian/oldstable
Debian/3.0
Debian/sarge
Debian/stable
Debian/3.1
Debian/etch
Debian/testing
Debian/sid
Debian/unstable
RedHat/RHEL3
RedHat/RHEL4
SuSE/SLES9-IA32
SuSE/SUSE91-IA32
SuSE/SUSE100-IA32
SuSE/SUSE92-IA32
SuSE/SUSE93-IA32
SuSE/SUSE101-IA32
Ubuntu/warty
Ubuntu/4.10
Ubuntu/hoary
Ubuntu/5.04
Ubuntu/breezy
Ubuntu/5.10

  • Build an RPM for your Linux distribution, taking the name from the list above, e.g. SuSE/SUSE100-IA32 for SuSE 10.0:
    
    ./ati-driver-installer-8.19.10-i386.run --buildpkg SuSE/SUSE100-IA32
    
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Install the newly built RPM, the name depends again on your choice above, e.g.:
    
    rpm -Uhv fglrx_6_8_0_SUSE100-8.19.10-1.i386.rpm
    
    

  • Check that the GCC compiler output does not say 'ERROR' (warnings are allowed).

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes".

  • Reboot the machine.

  • Log in, open a console and type
    fglrxinfo
    

The output should now look similar to this one, with ATI Technologies as the OpenGL vendor:


display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3.1017 (X4.3.0-8.19.10)

If this worked, you are done and ready to run YASARA. Congratulations.

If you finally run YASARA, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .

Installation instructions for the old *.rpm drivers (until 2005)

You receive an RPM whose name usually looks like fglrx-[XServerVersion]-[DriverVersion].i386.rpm, e.g. fglrx-4.3.0-3.7.6.i386.rpm

ATI provides detailed installation instructions, however installation tends to fail easily.

Here are some hints:

  • Make sure to pick the ATI driver that matches your X-server. For recent Linux distributions (spring 2004), [XServerVersion] is usually 4.3.0. If you are not sure, type
    more /var/log/XFree86.0.log
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Check that you have the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. for RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs, they usually reside on disk 3. If the installation of the kernel sources fails with an error box, do it manually:
    
    mount /mnt/cdrom
    cd /mnt/cdrom/[YourLinuxName]/RPMS
    rpm -i kernel-source-[KernelVersion etc.].rpm
    
    
    Now check that /usr/src/linux-[YourKernelVersion] is present.

If you accidentally tried to install the RPM without the kernel source present, you may have gotten this error message:

*** Error: no kernel module build environment - please consult readme.

  • Install the ATI driver RPM:
    rpm -Uh --force fglrx-[XServerVersion]-[DriverVersion].i386.rpm
    

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes". There is also a question about quad-buffered stereo, but we have not had much luck with this one.

  • Restart the X-server:
    startx
    

  • Check the configuration:
    fglrxinfo
    

If the output looks about like that, you are done and can run YASARA:

display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3 (X4.3.0-3.7.6)

If you still see "Mesa" in the OpenGL vendor string, open the file /var/log/XFree86.0.log in a text editor and search for this message:


(EE) fglrx(0): [agp] unable to acquire AGP, error "xf86_ENOMEM"
(EE) fglrx(0): cannot init AGP
....
(WW) fglrx(0): ***********************************************
(WW) fglrx(0): * DRI initialization failed!                  *
(WW) fglrx(0): * (maybe driver kernel module missing or bad) *
(WW) fglrx(0): * 2D acceleraton available (MMIO)             *
(WW) fglrx(0): * no 3D acceleration available                *
(WW) fglrx(0): ********************************************* *

This error message indicates problems with your AGP support. Exit X and type as root
/sbin/insmod agpgart
. Restart X and try again
fglrxinfo
. If it works now, you are ready for YASARA. Note that this fix is temporary.

  • Run YASARA.

If you still have problems, make sure that you really install the latest ATI driver. The first releases were very buggy, and only with version 3.7.6 did ATI reach good quality. Version 3.7.6 works well with most Radeon cards, e.g. the 9200, 9600 series.

If YASARA finally runs, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .

° 

You are running Linux with a Xig graphics driver

Xi graphics www.xig.com distributes a commercial X-server with hardware accelerated OpenGL graphics that supports mainly ATI graphics chips up to the Radeon 9200.

Prices for these drivers with OpenGL functionality start at 69$, which is the same amount of money you would have to pay for a new GeforceFX card including drivers from nVIDIA that deliver significantly higher performance. ATI also provides faster Linux drivers.

There is mainly one situation where the Xig drivers can be very helpful: if you already own a fast ATI 9200 card and absolutely need quad-buffered stereo. Then you can buy the Xig Summit DX Platinum driver for 89$, which is much cheaper than a stereo-capable Quadro card from nVIDIA.

YASARA was tested with an ATI Radeon 9200 and the Summit_DX-Platinum driver version 2.2-16. Once some installation issued are solved, the Xig OpenGL driver runs out of the box without any visual glitches, albeit at lower speed and less smoothly than the flgrx driver from ATI.

Xig provides detailed installation instructions, nevertheless here are some hints to avoid common pitfalls:

  • Download the file Summit_DX-Platinum-[Version].tar from www.xig.com.

  • If your directory /usr/src does not contain a linux* subdirectory, install the kernel source RPMs for your Linux distribution.

  • Go to directory /usr/src and make sure that there is a symbolic link 'linux' pointing to the subdirectory that contains the kernel source. As an example, Fedora Core 1 has the kernel sources in the subdirectory 'linux-2.4.22-1.2129.nptl', so you would use this command:
    ln -s linux-2.4.22-1.2129.nptl linux
    

  • Untar the driver archive:
    tar -xvf Summit_DX-Platinum-[Version].tar
    

  • Try to remove existing Mesa drivers:
    rpm -e --nodeps Mesa
    
    This may fail.

  • Install the kernel module: e.g.
    rpm -i xsvc-3.0-50.i386.rpm
    

  • Install the OpenGL driver:
    rpm -i Summit_DX-Platinum-2.2-16.i386.rpm
    

  • Make sure you have this line in /etc/modules.conf:
    alias char-major-10-179 xsvc
    

  • Make sure the kernel driver is loaded:
    /sbin/modprobe xsvc
    

  • Configure your desktop: run
    Xsetup
    

  • Start the Xserver:
    startx
    

  • Open a terminal and type
    glxinfo
    
    If you see the following output, you are done and can start YASARA:


server glx vendor string: Xi Graphics, Inc.
server glx version string: 1.4
server glx extensions:
    GLX_ARB_get_proc_address, GLX_ARB_multisample, GLX_EXT_visual_info,
    GLX_EXT_visual_rating, GLX_EXT_import_context, GLX_SGI_make_current_read,
    GLX_SGIS_multisample, GLX_SGIX_fbconfig, GLX_SGIX_pbuffer
client glx vendor string: Xi Graphics, Inc.
client glx version string: 1.4
client glx extensions:

If it did not work, look at the various FAQ files provided by Xig in the Summit_DX-Platinum directory you untared and in /usr/src/xig.

° 

You are using a notebook

Apart from the trivial fact that notebooks often do not have sufficient OpenGL capabilities, another speed issue was reported on some notebooks with Pentium 4 processor, which react very slowly when using animated windows (blend, rotate). The reason is that many companies sell expensive 2GHz notebooks, but the processor runs permanently at 1.2GHz, even with heavy system load and a connected power supply. Nevertheless, Windows reports a CPU clock frequency of 2GHz, which leads to timing issues. To solve this problem, go to Control Panel > Power options > Power schemes and make sure that you choose a 'Desktop' setting.

° 

You have an Intel 82845G graphics chip

While YASARA normally runs nicely with this chipset, performance drops heavily as soon as you assign atom colors other than red, green, blue, cyan, magenta, yellow and gray. The driver seems to switch back to software rendering in this case. Edit the file yasara.ini and set VisualQual to 1.

° 

You have an Intel 82865G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. (In WinXP, location may differ slightly in WinNT). You will see the driver date and driver version.

YASARA has been tested with driver version number 6.13.10.3510 and date 15-4-2003. If your driver is from an earlier date with a smaller version number, it contains too many bugs and you have to update it (go to www.intel.com ). At the time of writing, version 13.5.0.3691 is the latest one.

° 

You have an Intel 82915G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. You will see the driver date and driver version.

YASARA has been tested with driver version number 6.14.10.3943 and date 02-11-2004. If your driver is from an earlier date with a smaller version number, it contains serious bugs like the menus turning black when you move the pointer out of the YASARA window. Please install the latest drivers from www.intel.com.

  • Drivers 6.14.10.3889 and older have a problem with the task manager. If you bring it up with <Ctrl>+<Alt>+<Del>, the OpenGL graphics may be corrupted after returning. Also if you request too much memory in yasara.ini, the driver may switch to software rendering, thus making everything unusably slow.

  • Driver 6.14.10.3943 still has a little bug that occasionally makes the mouse pointer freeze for half a second.

° 

You have an S3 graphics chip

Many of the S3 chips (e.g. ProSavage DDR) are advertised with OpenGL compatibility but use terribly slow software rendering instead. You can try to download their latest drivers from www.s3graphics.com, maybe they fixed the problems in the mean time. Do not be disappointed if you cannot run YASARA at a usable speed with these chips.

° 

You have a SiS M650 graphics chip

When using a SiS M650 graphics chip (sometimes found in cheap notebooks), it may happen that molecules are too dark and change their brightness abruptly. Debugging indicated that the SiS OpenGL driver does not display the fog properly. Click on View > Lightning > Fog and set it to 0 to disable the fog completely.

° 

You have a 3DLabs Wildcat card

Problems running YASARA were reported for a Wildcat III 6110. The problem has been reported to 3DLabs.