Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA quits with a red error box or crashes sometime later

The following reasons for a red error box are known inconveniences:

  • Error 2 - Essential videomode not supported: if you try to go fullscreen on an extremely high resolution screen (or two screens combined with TwinView), YASARA's resolution limits may be exceeded. More details can be found here and here.

  • Error 7 - Out of memory: algorithms in structural bioinformatics can be quite memory intensive, e.g. if they need to build a three-dimensional grid. Unfortunately operating systems still have trouble dealing with applications that request too much memory, often freezing your entire computer and causing the loss of all unsaved documents. To keep your data safe, YASARA never uses more memory than you assign via the 'Memory' setting in the file yasara.ini. The percentage of memory left is shown in the bottom left corner. If more memory is needed, YASARA will either display a simple error message or exit immediately, offering you the option to save the current scene. If raising the 'Memory' limit does not help, check if your input file accidentally contains lost atoms, that are micrometers away from the others, and delete them:
    
    DelRes LocalX<-1000 or LocalX>1000 or LocalY<-1000 or LocalY>1000 or LocalZ<-1000 or LocalZ>1000
    
    

In some very rare cases, YASARA may encounter a serious problem that makes it impossible to continue running the program. You will then see a red error box with a problem description and the option to rescue your work by saving it as a complete YASARA scene 'errorexit.sce', which you can load after restarting YASARA.

In some even rarer cases, YASARA might even crash completely without furthur notice. In either case, you will get a 10 EUR reward for reporting this problem in a reproducible way.

If you have Python installed, simply restart YASARA and click on Help > Report error.

If you do not have Python installed, do it manually by going to www.yasara.org/bugreport . For problems that are not obvious, it is usually essential to send us the last execution log. You can find these logs in the directory yasara\log with names like exec_XXXX.log, and usually the newest file is the one which contains the list of commands that lead to the crash.

Other potential causes for Windows crashes:

  • Occasional crashes were reported for a dual core machine equipped with an ATI Radeon X600 PRO card and ATI driver version 6.14.10.6542 from 2005. The Windows crash report indicated that the ATI driver module atioglxx.dll was to be blamed. Updating the Radeon driver to Catalyst 6.6 solved the problem.

  • ATI Catalyst 6.11 from 2006 with OpenGL driver 6.14.10.5819 was reported to crash on an ATI Radeon 7000 card with only 32MB video ram and two connected monitors. Closer inspection showed that the driver couldn't cope with the exhausted video ram. The problem could be solved by not expanding the desktop over both monitors.

Other potential causes for Linux crashes:

  • You run a 64bit Linux with an nVIDIA card: driver version 76.76 (see output of glxinfo) was reported to occasionally crash Linux, causing the following message in /var/log/messages: Kernel BUG at "arch/x86_64/mm/pageattr.c":154. Update to the latest driver version.