Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You never get less than you want

Most commands you can choose with the mouse will show you a little pop-up menu where you can define the final selection type. Usually 'All', 'Object', 'Molecule', 'Residue ' or 'Atom'. It is important to remember that you can never get less than the type you choose. So if you click on View > Color > Residue, you will always color entire residues, no matter what you do. Even if you then pick 'Sidechain' in the list titled 'Belongs to or contains', you will not color just the side-chains, but instead all residues that contain side-chains (so no glycines).

If you want to color just the side-chains alone, note that a side-chain is less than a residue, so go to View > Color > Atom and pick 'Sidechain' in the list titled 'Belongs to or contains'. Either select the residues in the list on the left side, or type them in the manual selection field at the bottom, e.g. Res 10-20

The same principle holds when creating a color gradient: The color only changes between the units of the selected type.

  • To color all objects in an NMR bundle with a different color, go to View > Color > Object > Apply gradient
  • To color all molecules in an oligomer with a different color, go to View > Color > Molecule > Apply gradient
  • To color all residues in a molecule with a different color, go to View > Color > Residue > Apply gradient