Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Yanaconda macros can include each other

Sometimes a certain macro is needed at more than one place. Instead of copying macros manually between files, you can use the 'include' statement to let a macro include other macros:


# Solve an NMR structure
# First fold it from the stretched out conformation
include nmr_fold
# Then refine it in vacuo
include nmr_refinevac
# And then in water
include nmr_refinewat

  • The 'include' statement does not have to be placed in the first column (YASARA will instead automatically indent the included file as well).

  • YASARA includes the other macros BEFORE running the macro, just like a C preprocessor includes header files before compilation. As a consequence, the line numbers reported in case of errors refer to the complete macro, with all the others included. Also Yanaconda language features like explicit evaluators cannot be resolved.

  • The path specified after 'include' may be absolute or relative. In the latter case it is taken relative to the directory containing the including macro, but not relative to the current working directory.