Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Yanaconda macros can access predefined variables

Some variables are predefined to make life easier, they are just normal variables and can be overwritten.

View 1 if the stage of your YASARA is at least View, always true
Model 1 if the stage of your YASARA is at least Model (true for Model, Dynamics, Structure), 0 otherwise
Dynamics 1 if the stage of your YASARA is at least Dynamics (true for Dynamics, Structure), 0 otherwise
Structure 1 if the stage of your YASARA is at least Structure (true for Structure only), 0 otherwise
Twinset 1 if you have the Twinset installed
Movie 1 if you are running YASARA Movie
Linux 1 if the operating system is Linux
MacOS 1 if the operating system is MacOSX
Windows 1 if the operating system is Windows
MacroDir Directory where the current macro resides
MacroTarget Target set for this macro with the MacroTarget command
Atoms Number of atoms in the soup, see also Count
Objects Number of objects in the soup , see also Count
FirstObj Number of first active object, -1 if no object is active
LastObj Number of last active object , -1 if no object defined
EnergyUnit Current EnergyUnit, either 'kcal/mol' or 'kJ/mol'
SpeedMax The current speed of the fastest atom in the simulation in m/s
Pi The value of Pi, 3.14159265359
Pid The ID of the current process (helpful if you create temporary files)
PDBDir Directory of the local PDB as specified in yasara.ini
LeftButton 1 if the left mouse button is currently pressed
MiddleButton 1 if the middle mouse button is currently pressed
RightButton 1 if the right mouse button is currently pressed
ContinueButton1 if the command 'ShowButton Continue' has been issued and the button is pressed
FirstName Your first name, type Print 'Hi (FirstName)!' to greet yourself.
LastName Your last name
ScrSizeX The width of the YASARA window in pixels
ScrSizeY The height of the YASARA window in pixels
PixToA Conversion factor from pixels to Angstroms
EyeDis Distance between the eye/camera and the viewplane in Angstroms