Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Yanaconda is a reinterpreted language

The only language the processor can understand is machine code. The low-level Assembly language is just a way to make machine code readable for humans. High-level languages like C/C++ must be translated to machine code by a compiler, or to an intermediate 'byte-code' that can be executed by an interpreter (Python,Perl).

Yanaconda is one additional level 'higher' (and slower, which is not an issue because virtually all of the time is spent in YASARA commands anyway). The source code is reinterpreted continuously and can modify itself using 'explicit evaluators' described below. This revival of 'self-modifying code' allows for surprising shortcuts that can increase readability and efficiency at the same time.