Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Yanaconda is Yet ANother Abridged COding 'N' Development Approach

Why yet another macro language? Why not use Python directly, as it is possible in YASARA plugins? There are two simple reasons:

  • Many users prefer not to use the graphical interface, but type the commands directly in the console to save time. In this case, every keystroke is a precious resource, and Yanaconda has been designed to minimize the number of keystrokes while maximizing the readability of the code.

So if you quickly want to color all CA and CB atoms blue, you type:


coloratom ca cb,blue

Because the command above is not a valid Python syntax, you would have to type:


ColorAtom("ca cb","blue")

In the first case, it takes 20 keystrokes, in the second case 33 (counting SHIFTs), that's 65% more. The quick way is possible because Yanaconda is not case sensitive and the command 'ColorAtom' knows its argument types and does not expect quotes around strings.

When writing a macro that will be used again, you would invest more time and choose a more readable form of the command, with the same result:


ColorAtom CA CB,Blue

  • Not everyone knows how to (or likes to) program in Python, and Yanaconda can be seen as a minimal common set of instructions that everyone knowing at least one other programming language can memorize in ten minutes. (If Yanaconda is your first 'programming language' it may take 30 minutes).