Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Yanaconda helps to define selection subsets

It is sometimes convenient to store selections under a certain set name to reuse them again later, e.g. all residues that are in contact with a ligand.

This can easily be achieved in a macro, by defining the selection as a string:

MySet1 = 'all with Distance<5 from Res OUA'
MySet2 = 'Res Lys Arg'
# Show all atoms closer than 5 Angstrom to residue OUA
ShowAtom (MySet1)
# And color them yellow
ColorAtom (MySet1),yellow
# Style all lysine plus arginine side-chains as sticks.
StickAtom (MySet2)