Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA hangs, but other programs are not affected

What looks like a freeze, may actually only be a long delay caused by a lengthy calculation. YASARA normally uses progress bars to provide visual feedback, but if you are working with extremely large structures containing 100000s of atoms, even simple things can take a long time. Look here for some hints how to improve performance.

  • If you are using the Twinset, just switching to a WHAT IF menu can already take a long time (30+ seconds), especially if there are 10000s of water molecules present. Try to remove the objects containing water molecules before using WHAT IF functions.

  • If your molecule is not extremely large and you are not using WHAT IF functions, then please contact support@yasara.org, providing the scene that caused the hang.