Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

If you are running Windows 95 to XP, click on Start > Control Panel > Display > Settings > Advanced > maybe 'Adapter' or 'Options', depends on your card. In Windows NT, the usual location is Start > Settings > Control Panel > Display > Settings > Display type. Somewhere around there, you should find the name of your graphics card and the driver version (e.g. a list of *.dll files).

In Windows Vista, click Start > Control panel > Classic View > Device Manager > Display adapters. Double-click on your display adapter, then click 'Driver'.

In Linux, open a terminal and type
glxinfo
to display information about your OpenGL driver.

If you purchased your graphics card before 2000, it may be a problem to run YASARA at a usable speed. The reason is usually not that the graphics card is too weak, but that there is not enough video memory and the driver switches back to software rendering. Nevertheless, YASARA runs OK on a Matrox G400 with 16MB ram. First edit the file yasara.ini and set VisualQual to 0, then reduce your screen color depth to 16 bits (65536 colors), and the screen resolution to <=1024x768. If this helps, try subsequently higher resolutions. If you have less than 16MB ram on your video card, it's probably best to just get a new one.

Examples of cards that are just too old for YASARA:
  • ATI Mach, Rage IIC, Rage XL, Rage XC
  • All 3DFX Voodoo cards
  • Matrox Mystique