Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You have an Intel 82915G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. You will see the driver date and driver version.

YASARA has been tested with driver version number 6.14.10.3943 and date 02-11-2004. If your driver is from an earlier date with a smaller version number, it contains serious bugs like the menus turning black when you move the pointer out of the YASARA window. Please install the latest drivers from www.intel.com.

  • Drivers 6.14.10.3889 and older have a problem with the task manager. If you bring it up with <Ctrl>+<Alt>+<Del>, the OpenGL graphics may be corrupted after returning. Also if you request too much memory in yasara.ini, the driver may switch to software rendering, thus making everything unusably slow.

  • Driver 6.14.10.3943 still has a little bug that occasionally makes the mouse pointer freeze for half a second.