Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You have an Intel 82865G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. (In WinXP, location may differ slightly in WinNT). You will see the driver date and driver version.

YASARA has been tested with driver version number 6.13.10.3510 and date 15-4-2003. If your driver is from an earlier date with a smaller version number, it contains too many bugs and you have to update it (go to www.intel.com ). At the time of writing, version 13.5.0.3691 is the latest one.