Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA gets stuck in the startup screen

If YASARA displays the startup screen with the message 'Initializing graphics engine...' at the bottom, but nothing else happens, this can have a number of reasons:

  • Your OpenGL driver may have a serious performance problem. This is the case with Matrox G400-G550 cards, that need three minutes to get past the startup screen. Go for a cup of coffee, this happens only the first time and when you try to resize the window. Anyway, the three spare minutes are probably a good time to get a new graphics card.

  • While the startup screen is displayed, YASARA runs extensive OpenGL calibration algorithms, which may cause broken OpenGL drivers to hang. Most of the time, this happens in Linux and indicates that you need to install a new OpenGL driver. Click here for more details.