Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA does not start

° 

YASARA does not start from CD

This can happen under Linux, when you mounted the CD with the wrong flags. You then get a 'Permission denied' error message. To solve the problem, open the file /etc/fstab and search for a line like the following:


/dev/cdrom   /mnt/cdrom       iso9660 ro,user,exec,noatime    0  0

Now make sure that you have the exec and noatime flags set, then remount the CD.

° 

You are using Windows and nothing happens when you start YASARA

The most likely reason is that you do not have enough memory: Your computer needs to have a total of 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

Another rare cause for this problem was reported by users who had anti-virus software like TrendMicro2005 activated with maximum security settings. These programs may silently prevent you from running any software that has been downloaded from the web. Temporarily deactivate the tool, then run YASARA again.

° 

A message about /dev/nvidiactl permission problems appears in the Linux terminal

If YASARA does not start, but a message like


Error: Could not open /dev/nvidiactl because the permissions
       are too restrictive.  Please see the FREQUENTLY ASKED QUESTIONS
       section of /usr/share/doc/NVIDIA_GLX-1.0/README for steps
       to correct.

appears, become root and run the following commands:

chmod 0666 /dev/nvidia*
chown root /dev/nvidia*

To prevent the problem from reappearing, it may help to reconfigure the security module of the PAM system. In most cases this security system works, but it can get confused. Different Linux distributions have different files to control this; please consult with your distributor for the correct method of disabling this security feature. As an example, if your system has the file /etc/security/console.perms then you should edit the file and remove the line that starts with 'dri' (we have also received reports that additional references to dri in console.perms must be removed). If instead your system has the file /etc/logindevperms then you should edit the file and remove the line that lists /dev/nvidiactl. The above steps will prevent the PAM security system from modifying the permissions on the NVIDIA device files.

° 

'Killed' or 'Segmentation fault' appears in the Linux terminal

This message indicates that the operating system decided to kill YASARA instead of running it. The most likely reason is that you do not have enough RAM to run YASARA without exhausting your swap space and freezing your system. Your computer needs to have 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

To check your configuration, open a terminal and type

free

The output should look roughly like this one:

             total       used       free     shared    buffers     cached
Mem:        255240(a)  239944      15296          0      11332     112944
-/+ buffers/cache:     115668     139572
Swap:       522072(b)     252     521820

To run YASARA, the number marked (a) should be >120000, while (b) should be >250000. For the Twinset, (a) should be >500000 and (b) should be >1000000.

If you meet these requirements and still get killed, edit the file yasara.ini and change the 'Memory' field like that:

Memory 48

If that works, you can subsequently assign larger amounts of memory to YASARA.

If it still does not work, type


ulimit -a

and check that all memory options are set to 'unlimited':

max locked memory     (kbytes, -l) unlimited
max memory size       (kbytes, -m) unlimited
virtual memory        (kbytes, -v) unlimited

If this is not the case, set them to unlimited:

ulimit -l unlimited
ulimit -m unlimited
ulimit -v unlimited

Some of this changes may only be made by user 'root'. To make them permanent, you have to edit the file /etc/security/limits.conf and add the lines

* hard memlock unlimited
* soft memlock unlimited
* hard rss unlimited
* soft rss unlimited
* hard data unlimited
* soft data unlimited

And afterwards reboot the machine.

° 

'Error while loading shared libraries' appears in the Linux terminal

To make the YASARA executable small, it is dynamically linked to a number of libraries that are normally installed in every Linux distribution since 2000. If you encounter the problem, please contact support@yasara.org and provide details about your Linux distribution, as well as the output of this command:


ldd ./yasara

We will then quickly send you a new download link that solves the problem.

Alternatively, you can install the missing library yourself, assuming that you know the root password on your machine or your system administrator allows 'sudo' access to package installation.

A special case are 64bit Linux distributions (AMD64): especially (K)Ubuntu normally comes without backwards compatible support for 32bit applications, look here for a solution .

° 

A red box appears: Error 2 - Essential videomode not supported under Linux

One possible explanation is that YASARA tried to enter fullscreen mode using an extremely high resolution screen (or two screens combined with TwinView etc.). In this case just delete the file yasara/yasara.ini and restart.

If this does not help, open a terminal, type glxinfo and check the output for available visuals. It should look a bit like that:


   visual  x  bf lv rg d st colorbuffer ax dp st accumbuffer  ms  cav
 id dep cl sp sz l  ci b ro  r  g  b  a bf th cl  r  g  b  a ns b eat
----------------------------------------------------------------------
0x21 16 tc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x22 16 dc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x23 16 tc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x24 16 tc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x25 16 tc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x26 16 dc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x27 16 dc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x28 16 dc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None

If you get nothing comparable, you need to install OpenGL drivers for your video card. Contact your system administrator if you do not have the root password, otherwise visit www.nvidia.com or www.ati.com for more details.

° 

A red box appears: Error 53 or 353 - No vector registers available or wrong CPU architecture

There are two reasons for this error message:

  • When downloading YASARA, you selected a different CPU than the one in your computer. Go to www.yasara.org/update, input the serial number that is listed in our mail with the initial download link, and choose 'Many different, I want to install on multiple PCs' as your CPU.

  • When downloading YASARA, you did not select a specific CPU. In this case, the processor in your PC is either many many years too old for molecular modeling (Pentium MMX, Pentium II, AMD K6 etc.) or a rather exotic model that is incompatible with the current mainstream CPUs. You can unfortunately not run YASARA on this PC.

° 

A red box appears: Error 93 - Center of YASARA window off screen

  • If you have been able to start YASARA in the past, then the reason for this error is most likely the one described in the error box. Restart YASARA, and if this does not help, delete the file yasara.ini to set the window size back to the default.

  • If this is the first time you try to run YASARA, then the reason for this error is almost certainly a bug or incomplete functionality in your OpenGL graphics driver. The following hardware configurations have been reported to occasionally cause this problem:

  • Linux with some ATI Radeon cards and a Tungsten Graphics/Mesa DRI OpenGL driver. Type
    glxinfo
    
    and check if the output contains the following lines:
    
    OpenGL vendor string: Tungsten Graphics, Inc.
    OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
    OpenGL version string: 1.2 Mesa 4.0.4
    
    
    If this is indeed the case, click here for instructions how to install the high-performance ATI Radeon graphics driver.

  • Windows with some exotic, not entirely OpenGL compliant integrated graphics chipsets like the SiS Mirage 2 (SiS760GX chipset, version 3.75). Please notify us if a newer driver version solves the problem.

° 

The YASARA windows stays empty and black in Linux

This problem was observed in Fedora Core 6 as soon as 3D desktop effects were activated. Updating the X-server to the latest version (1.1.1-47.7.fc6) solved the issue.