Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA does not behave as expected with two or more connected monitors

If you connect two or more monitors or beamers to your graphics card, there are normally two ways of making use of the extra space:

  • A single desktop covers both monitors: this approach is called 'TwinView' by nVIDIA and 'DualHead' by ATI. You can in principle resize the YASARA window to cover both monitors, as long as the window size does not exceed YASARA's maximal resolution. (In the latter case, YASARA will reduce the size again). Mac OS X may not allow you to move the YASARA window to a certain monitor and keep it there, in this case simply click Window > Fix on screen. Windows may interfere with your attempts to place the YASARA window correctly, in this case it may help to set 'CorrectWin' in yasara.ini to 0 to avoid window size corrections. If you go fullscreen, it depends on your operating system and graphics card what will happen. The YASARA window may fully cover both monitors (this can fail with nVIDIA cards in Linux, which may show you (part of) the same image on both monitors), or it may cover only one of the monitors. YASARA cannot influence on which monitor it goes fullscreen. You have to adjust this behavior yourself in the DualHead/TwinView section of your video driver.

  • Each monitor shows its own desktop: this approach is available in Linux. There is an application menu on each monitor, and programs stay on the monitor where you launched them. If you maximize the YASARA window, it will cover the monitor where it was launched. If you go fullscreen, YASARA will go fullscreen where you launched it. Since this also captures the mouse, you will not be able to move the pointer back to the other monitor unless you leave fullscreen mode.

Here are instructions on how to modify the file /etc/X11/xorg.conf to activate the mode described above on nVIDIA cards:

First, create two separate Device sections, each listing the BusID of the graphics card to be shared and listing the driver as "nvidia", and assign each a separate screen:

Section "Device"
    Identifier  "nvidia0"
    Driver      "nvidia"
    # Edit the BusID with the location of your graphics card
    BusID       "PCI:2:0:0"
    Screen      0
EndSection

Section "Device"
    Identifier  "nvidia1"
    Driver      "nvidia"
    # Edit the BusID with the location of your graphics card
    BusId       "PCI:2:0:0"
    Screen      1
EndSection

Then, create two Screen sections, each using one of the Device sections:

Section "Screen"
    Identifier  "Screen0"
    Device      "nvidia0"
    Monitor     "Monitor0"
    DefaultDepth 24
    Subsection "Display"
        Depth       24
        Modes       "1600x1200" "1024x768" "800x600" "640x480"
    EndSubsection
EndSection

Section "Screen"
    Identifier  "Screen1"
    Device      "nvidia1"
    Monitor     "Monitor1"
    DefaultDepth 24
    Subsection "Display"
        Depth       24
        Modes       "1600x1200" "1024x768" "800x600" "640x480"
    EndSubsection
EndSection

(Note: You'll also need to create a second Monitor section) Finally, update the ServerLayout section to use and position both Screen sections:

Section "ServerLayout"
    ...
    Screen         0 "Screen0"
    Screen         1 "Screen1" leftOf "Screen0"
    ...
EndSection

For further details, please refer to the XF86Config(5x) or xorg.conf(5x) manpages.