Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA displays a warning at the bottom of the startup screen

All these warnings are non-fatal, YASARA will run normally. If it does not, the reason lies somewhere else.

° 

Warning

-

Python not found

YASARA plugins use the Python scripting language. If Python is not installed, these plugins will not be loaded and some convenient options will be missing in the menus (e.g. to get PDB files from the web). Just click Help > Install program > Python to install it, or alternatively download Python from www.python.org . You need to restart YASARA afterwards.

An alterative explanation is that your computer is running short of swap space and YASARA cannot run Python. Look here for more details.

° 

Warning

-

Screen update not synchronized

In order to display graphics smoothly, YASARA should redraw the screen synchronously with your monitor, otherwise you may encounter so called 'tearing effects'. Not all graphics cards allow you to activate this option.

In Windows try to go to Control Panel > Display > Settings > Advanced > OpenGL and see if there (or close by) is an option called 'Activate Sync to VBlank'.

In Linux, it depends on your graphics card. nVIDIA cards should be handled automatically by YASARA. Until 2006, ATI Radeon drivers allowed you to activate this option during the installation. Nowadays you can simply run as root 'aticonfig --sync-vsync=on' and then restart the X-server. Unfortunately this does not always work.

In MacOSX, YASARA normally activates the synchronization automatically. If you nevertheless get the warning, it points towards an internal MacOSX problem.