Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA displays an error-like message in the terminal

° 

The message '*** Assertion failure in -[NSEvent deviceDeltaX]' appears in the terminal

This warning appears when you switch between the MacBook TrackPad and an external mouse with scroll wheel. The message is caused by a chain of design bugs in MacOSX, and can safely be ignored.

° 

The message 'Disabled smooth atom colors' appears in the terminal

When you start YASARA under Linux and get the message
Disabled smooth atom colors because OpenGL extension XY is not supported
then your OpenGL driver is either very old or not installed properly. YASARA still runs, but it can display only the following atom colors: blue, magenta, red, yellow, green, cyan and gray, e.g. smooth color gradients will only be visible in ribbons and ray-traced output, but not in the individual atoms on screen.

This problem sometimes comes together with an error message about extension "XFree86-DRI" missing on display ":0.0" .

° 

The message 'disabling TCL support' appears in the terminal

If the message 'Loading required GL library /usr/X11R6/lib/libGL.so.1.2 disabling TCL support' appears in the terminal, this indicates that your OpenGL driver is not installed properly. This was reported for the default installation of some ATI Radeon cards, and YASARA may subsequently hang in the startup screen. Click here for instructions how to install proper Radeon drivers .

° 

The message 'libgcc_s.so.1 must be installed for pthread_cancel to work' appears in the terminal

This warning may appear on some Redhat Linux distributions and is normally harmless. To get rid of the message, install the compat-glibc RPM, for example compat-glibc-7.x-2.2.4.32.6.i386.rpm.

In another case where this error message was not harmless but prevented YASARA from running, it turned out that the reason was third party software that changed environment variables to replace system libraries. Removing these changes solved the problem.

° 

The message 'libGL warning: 3D driver claims to not support visual 0x4b' appears in the terminal

This warning is not related to YASARA and affects all OpenGL applications. Rumours are that it is caused by a Linux kernel problem, occurs in all distributions with certain video chips (e.g. Intel) and will be resolved in kernel 2.6.20. Fortunately YASARA runs correctly, the message can thus be ignored.

° 

The message 'Mesa X.Y.Z implementation error' appears in the terminal

This bug was observed with Radeon 9600 cards in Linux, it has been reported to freedesktop.org Click View > Lighting and set 'Ambient influence' and 'Shadow density' to 0 as a workaround.

° 

The message 'XFree86-DRI missing' appears in the terminal

When you start YASARA under Linux and get the message
Xlib: extension "XFree86-DRI" missing on display ":0.0"
this indicates that your OpenGL driver is not installed properly. This happens for example when installing an old nVIDIA driver on a new Linux distribution with Kernel 2.6, e.g. Fedora Core 1. Do not ignore the message, you may encounter serious graphics problems and system hangs. Instead update to the latest driver.

If you absolutely have to use an old driver (for example because of stereo support), you can still modify the old nVIDIA driver to work with a new kernel: http://www.minion.de/nvidia.html and http://sh.nu/download/nvidia/linux-2.6/