Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

YASARA cannot be installed

° 

The message './install_yasara: No such file or directory' appears in the Linux terminal

This problem was observed in (K)Ubuntu AMD64 and is caused by their aim to squeeze the entire system on a single CD, at the cost of dropping backwards compatibility. You need to install the missing packages with this command:

sudo aptitude install ia32-libs

If this fails, for example because you do not have a direct internet connection, then surf to packages.ubuntu.com, scroll down to 'Search' and download the following packages manually:

libc6-i386
lib32gcc1
lib32stdc++6
lib32z1
ia32-libs

For each of these packages, type

sudo dpkg install NameOfThePackageWithAllExtensions