Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are using a notebook

Apart from the trivial fact that notebooks often do not have sufficient OpenGL capabilities, another speed issue was reported on some notebooks with Pentium 4 processor, which react very slowly when using animated windows (blend, rotate). The reason is that many companies sell expensive 2GHz notebooks, but the processor runs permanently at 1.2GHz, even with heavy system load and a connected power supply. Nevertheless, Windows reports a CPU clock frequency of 2GHz, which leads to timing issues. To solve this problem, go to Control Panel > Power options > Power schemes and make sure that you choose a 'Desktop' setting.