Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are using Windows and nothing happens when you start YASARA

The most likely reason is that you do not have enough memory: Your computer needs to have a total of 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

Another rare cause for this problem was reported by users who had anti-virus software like TrendMicro2005 activated with maximum security settings. These programs may silently prevent you from running any software that has been downloaded from the web. Temporarily deactivate the tool, then run YASARA again.