Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Windows with an nVIDIA card

In this case it is most likely a driver issue . During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers like.. 

nvopengl.dll 4.13.01.3082
In this nVIDIA example, 3082 is the driver version.

  • The original Microsoft drivers shipping with Windows XP are bugged and can cause YASARA to crash. Please download the latest driver from www.nvidia.com.

  • nVIDIA Geforce driver versions 3082 and earlier cannot run YASARA properly, installing new drivers (at least version 4523) solves the problem.

  • nVIDIA Quadro drivers around version 6693 have a bug that makes the YASARA console at the bottom of the window invisible. Updating to at least version 7184 solves the problem.