Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Windows with an ATI Radeon card
In this case it is most likely a driver issue. During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers.

  • ATI driver version 6.14.10.6542 from 2005 was reported to show completely corrupted graphics on a dual core machine with an ATI Radeon X600 PRO card. Updating the Radeon driver to Catalyst 6.6 solved the problem.

  • ATI Catalyst 6.11 from 2006 with OpenGL driver 6.14.10.5819 was reported to show colorless ribbons and cartoons or even crash on an ATI Radeon 7000 card with 32MB video ram and two connected monitors. Closer inspection showed that the driver couldn't cope with the exhausted video ram. The problem could be solved by not expanding the desktop over both monitors.