Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Windows Vista

Microsoft unfortunately ships graphics drivers with reduced functionality, which support only very slow OpenGL software rendering and leave the power of your graphics card unused, except for the transparent Aero glass windows and video games.

Click Start > Control panel > Classic View > Device Manager > Display adapters to determine the manufacturer of your graphics chip. Double-click on your display adapter, then click 'Driver' to find your graphics driver version.

Known issues:

  • nVIDIA drivers 7.14.10.9677 and older are known not to accelerate graphics, downloading the latest Windows Vista driver from www.nvidia.com solves the problem. The new driver version should be 9.6.8.5 or higher.

  • Windows Vista is currently (2006/12/01) not well suited for running graphics intensive scientific applications like YASARA. Even with the latest nVIDIA drivers, the performance is only ~30% of what you get in Linux or Windows XP on the same machine. Try to avoid Windows Vista until Microsoft has solved the technical problems.