Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Linux with an nVIDIA card

nVIDIA does not allow Linux distributors to include their Geforce drivers. So a freshly installed Linux will run terribly slow with OpenGL applications, including YASARA. (Non-OpenGL programs like Rasmol will work fine however, that's why you may not have noticed it.)

Open a terminal and type

glxinfo | grep vendor

If the output does not show 'nVIDIA corporation' but 'SGI' and 'www.mesa3d.org', you DO NOT have an accelerated OpenGL installation and cannot use the power of your Geforce card.

To best way to install the required drivers depends on your Linux distribution. It is likely that your distribution offers prebuilt packages, which you can simply install with your package manager.

For (K)Ubuntu, the usual sequence of commands (after enabling the universe and multiverse repositories) is:

sudo apt-get update
sudo apt-get install nvidia-glx
sudo dpkg-reconfigure xserver.org (select 'nvidia' from the list)

Edit the file /etc/X11/xorg.conf, and follow the instructions below regarding dri and nvidia. The press <Ctrl>+<Alt>+<Backspace> to restart the X-server. If 'glxinfo | grep vendor' now displays nVIDIA, you are ready to go.

Fedora Core 5 is broken with respect to the official nVIDIA drivers. A solution is provided at http://www.fedorafaq.org/#nvidia. Even with this recipe, we got one or two reports of unexpected nVIDIA problems on Fedora Core 5.

If there are no prebuilt packages for your distribution , go to www.nvidia.com and download their latest Linux driver. They also provide detailed installation instructions. Note that you need the root password to install.

The probably most important thing when installing is that your X-server is not running. Press <Ctrl>+<Alt>+<F2> to switch to a text screen, log in as root and type
/sbin/init 3

Usually you type
sh ./NVIDIA-Linux-x86-1.0-[DriverVersion].run
to install (for SuSE Linux, add the parameter -q).

If this fails, you have to look in the file /var/log/nvidia-installer.log

After installing, you can find detailed instructions on how to proceed in the file
/usr/share/doc/NVIDIA_GLX-1.0/README

It is especially important to adapt the file /etc/X11/XF86Config or /etc/X11/xorg.conf:

  • In the 'Device' section, replace the line
    Driver "nv"
    
    with
    Driver "nvidia"
    

  • In the 'Module' section, delete the lines
    Load "dri"
    
    and (if present)
    Load "GLcore"
    
    and make sure you have
    Load "glx"
    

Now type
init 5
to restart X.

If completed successfully, 'glxinfo' should show 'NVIDIA Corporation' as OpenGL vendor. You can now restart YASARA.

Additional hints:

  • SuSE distributes some 'special editions' of e.g. SuSE 9.0 on one CD. You often find these bundled with computer magazines. Before you can install the nVIDIA drivers on such a special edition, you need to download the following RPMs from the SuSE FTP server:
    
    kernel-source
    glibc-devel
    make
    gcc
    
    

  • SuSE Linux requires to run sax2 after installing the nVIDIA drivers:


sax2 -r -m 0=nvidia (0 is a digit, not a letter!)

  • The Linux Compiz window manager for advanced desktop 3D effects was once reported to make the sticks between atoms disappear as soon as a non-standard atom colors are chosen.

  • On a Fedore Core 1 installation, you may get a complaint about a "Failed cc sanity check", which should be taken seriously. Do not follow the possibility to set the 'IGNORE_CC_MISMATCH' flag, this causes serious graphics problems and can freeze your system. Instead download the latest nVIDIA driver to solve this issue.