Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Linux with a Xig graphics driver

Xi graphics www.xig.com distributes a commercial X-server with hardware accelerated OpenGL graphics that supports mainly ATI graphics chips up to the Radeon 9200.

Prices for these drivers with OpenGL functionality start at 69$, which is the same amount of money you would have to pay for a new GeforceFX card including drivers from nVIDIA that deliver significantly higher performance. ATI also provides faster Linux drivers.

There is mainly one situation where the Xig drivers can be very helpful: if you already own a fast ATI 9200 card and absolutely need quad-buffered stereo. Then you can buy the Xig Summit DX Platinum driver for 89$, which is much cheaper than a stereo-capable Quadro card from nVIDIA.

YASARA was tested with an ATI Radeon 9200 and the Summit_DX-Platinum driver version 2.2-16. Once some installation issued are solved, the Xig OpenGL driver runs out of the box without any visual glitches, albeit at lower speed and less smoothly than the flgrx driver from ATI.

Xig provides detailed installation instructions, nevertheless here are some hints to avoid common pitfalls:

  • Download the file Summit_DX-Platinum-[Version].tar from www.xig.com.

  • If your directory /usr/src does not contain a linux* subdirectory, install the kernel source RPMs for your Linux distribution.

  • Go to directory /usr/src and make sure that there is a symbolic link 'linux' pointing to the subdirectory that contains the kernel source. As an example, Fedora Core 1 has the kernel sources in the subdirectory 'linux-2.4.22-1.2129.nptl', so you would use this command:
    ln -s linux-2.4.22-1.2129.nptl linux
    

  • Untar the driver archive:
    tar -xvf Summit_DX-Platinum-[Version].tar
    

  • Try to remove existing Mesa drivers:
    rpm -e --nodeps Mesa
    
    This may fail.

  • Install the kernel module: e.g.
    rpm -i xsvc-3.0-50.i386.rpm
    

  • Install the OpenGL driver:
    rpm -i Summit_DX-Platinum-2.2-16.i386.rpm
    

  • Make sure you have this line in /etc/modules.conf:
    alias char-major-10-179 xsvc
    

  • Make sure the kernel driver is loaded:
    /sbin/modprobe xsvc
    

  • Configure your desktop: run
    Xsetup
    

  • Start the Xserver:
    startx
    

  • Open a terminal and type
    glxinfo
    
    If you see the following output, you are done and can start YASARA:


server glx vendor string: Xi Graphics, Inc.
server glx version string: 1.4
server glx extensions:
    GLX_ARB_get_proc_address, GLX_ARB_multisample, GLX_EXT_visual_info,
    GLX_EXT_visual_rating, GLX_EXT_import_context, GLX_SGI_make_current_read,
    GLX_SGIS_multisample, GLX_SGIX_fbconfig, GLX_SGIX_pbuffer
client glx vendor string: Xi Graphics, Inc.
client glx version string: 1.4
client glx extensions:

If it did not work, look at the various FAQ files provided by Xig in the Summit_DX-Platinum directory you untared and in /usr/src/xig.