Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

You are running Linux with an ATI Radeon card

When running OpenGL applications in Linux, you should buy a graphics card from nVIDIA, since they provide the best graphics drivers that cause the least number of problems. ATI Linux drivers tend to expose graphics bugs, are often impossible to install or do not support the latest chips. This has gotten better lately with the takeover by AMD.

If your computer already contains an ATI Radeon card, there is a resonable chance that everything works correctly if you follow these hints:

NOTE: If you successfully installed the Radeon drivers and YASARA's user interface still lags behind, scroll to the end of this section.

Most default Linux installations (e.g. RedHat, Fedora) do not activate hardware accelerated OpenGL graphics for newer Radeon cards. Instead, only the unusably slow Mesa software emulation is available.

Open a terminal and type

glxinfo

If the output indicates that your OpenGL vendor is 'Tungsten Graphics', then there is a good chance that YASARA works correctly, especially on older Radeon chips (on Radeon 9600, you may get a 'Mesa implementation error' however, which can be worked around by disabling shadow and lighting at View > Lighting):


OpenGL vendor string: Tungsten Graphics, Inc.
OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
OpenGL version string: 1.2 Mesa 4.0.4

On the other hand, if you find the following in the output, you do not have hardware accelerated 3D graphics activated, and using YASARA with this configuration is hopeless:


OpenGL vendor string: Mesa project: www.mesa3d.org
OpenGL renderer string: Mesa GLX Indirect
OpenGL version string: 1.3 Mesa 4.0.4

In latter case, you need to install the proper driver from ATI: click on www.ati.com and download the latest Linux Radeon driver.

Installation instructions for Fedora Core

At least in Fedora Core 5 and 6, the drivers available from the ATI web site cannot be installed. The Fedora project however provides customized drivers as RPM packages in the livna repository:

  • Become root
  • Add the Livna repository to yum:
    rpm -Uhv http://rpm.livna.org/livna-release-6.rpm
    
  • Install the ATI kernel module and OpenGL driver (you can leave out *-32bit on 32bit systems)
    
    yum install kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    yum update kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    
    
  • Configure the driver:
    
    service ati-fglrx restart
    ati-fglrx-config-display enable
    
    
  • If you did not disable SELinux during installation:
    
    setsebool -P allow_execstack=1
    setsebool -P allow_execmod=1
    
    
  • Make sure that the file /etc/X11/xorg.conf contains the following sections:


Section "Module"
  Load "dbe"
  Load "extmod"
  Load "fbdevhw"
  Load "glx"
  Load "record"
  Load "freetype"
  Load "type1"
  Load "dri"
EndSection

Section "Device"
  Identifier  "aticonfig-Device[0]"
  Driver      "fglrx"
  Option      "VideoOverlay" "on"
  # This enables VSYNC
  Option      "Capabilities" "0x00000800"
EndSection

Section "ServerFlags"
  Option "AIGLX" "False"
EndSection

Section "DRI"
  Group 0
  Mode 0666
EndSection

Section "Extensions"
  Option "Composite" "False"
EndSection

  • Restart the X-server.
  • Open a terminal and verify that 'glxinfo' displays:
    
    ...
    OpenGL vendor string: ATI Technologies Inc.
    ...
    
    

Installation instructions for other Linux distributions and the new *.run drivers (2005 and later)

In 2005, ATI introduced a new installer (usually a big file >50 MB) with the extension '.run'.

  • Check that you have the GCC compiler as well as the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. in RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs. In SuSE, click System > YaST. Now check that /usr/src/linux-[YourKernelVersion] is present.

  • Download the installer from the ATI website, e.g. ati-driver-installer-8.19.10-i386.run.

  • Become root

  • Check that your Linux distribution is supported:
    ./ati-driver-installer-8.19.10-i386.run --get-supported
    

Example output:

ATI/XFree86-4_1_X
ATI/XFree86-4_2_X
Debian/woody
Debian/oldstable
Debian/3.0
Debian/sarge
Debian/stable
Debian/3.1
Debian/etch
Debian/testing
Debian/sid
Debian/unstable
RedHat/RHEL3
RedHat/RHEL4
SuSE/SLES9-IA32
SuSE/SUSE91-IA32
SuSE/SUSE100-IA32
SuSE/SUSE92-IA32
SuSE/SUSE93-IA32
SuSE/SUSE101-IA32
Ubuntu/warty
Ubuntu/4.10
Ubuntu/hoary
Ubuntu/5.04
Ubuntu/breezy
Ubuntu/5.10

  • Build an RPM for your Linux distribution, taking the name from the list above, e.g. SuSE/SUSE100-IA32 for SuSE 10.0:
    
    ./ati-driver-installer-8.19.10-i386.run --buildpkg SuSE/SUSE100-IA32
    
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Install the newly built RPM, the name depends again on your choice above, e.g.:
    
    rpm -Uhv fglrx_6_8_0_SUSE100-8.19.10-1.i386.rpm
    
    

  • Check that the GCC compiler output does not say 'ERROR' (warnings are allowed).

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes".

  • Reboot the machine.

  • Log in, open a console and type
    fglrxinfo
    

The output should now look similar to this one, with ATI Technologies as the OpenGL vendor:


display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3.1017 (X4.3.0-8.19.10)

If this worked, you are done and ready to run YASARA. Congratulations.

If you finally run YASARA, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .

Installation instructions for the old *.rpm drivers (until 2005)

You receive an RPM whose name usually looks like fglrx-[XServerVersion]-[DriverVersion].i386.rpm, e.g. fglrx-4.3.0-3.7.6.i386.rpm

ATI provides detailed installation instructions, however installation tends to fail easily.

Here are some hints:

  • Make sure to pick the ATI driver that matches your X-server. For recent Linux distributions (spring 2004), [XServerVersion] is usually 4.3.0. If you are not sure, type
    more /var/log/XFree86.0.log
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Check that you have the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. for RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs, they usually reside on disk 3. If the installation of the kernel sources fails with an error box, do it manually:
    
    mount /mnt/cdrom
    cd /mnt/cdrom/[YourLinuxName]/RPMS
    rpm -i kernel-source-[KernelVersion etc.].rpm
    
    
    Now check that /usr/src/linux-[YourKernelVersion] is present.

If you accidentally tried to install the RPM without the kernel source present, you may have gotten this error message:

*** Error: no kernel module build environment - please consult readme.

  • Install the ATI driver RPM:
    rpm -Uh --force fglrx-[XServerVersion]-[DriverVersion].i386.rpm
    

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes". There is also a question about quad-buffered stereo, but we have not had much luck with this one.

  • Restart the X-server:
    startx
    

  • Check the configuration:
    fglrxinfo
    

If the output looks about like that, you are done and can run YASARA:

display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3 (X4.3.0-3.7.6)

If you still see "Mesa" in the OpenGL vendor string, open the file /var/log/XFree86.0.log in a text editor and search for this message:


(EE) fglrx(0): [agp] unable to acquire AGP, error "xf86_ENOMEM"
(EE) fglrx(0): cannot init AGP
....
(WW) fglrx(0): ***********************************************
(WW) fglrx(0): * DRI initialization failed!                  *
(WW) fglrx(0): * (maybe driver kernel module missing or bad) *
(WW) fglrx(0): * 2D acceleraton available (MMIO)             *
(WW) fglrx(0): * no 3D acceleration available                *
(WW) fglrx(0): ********************************************* *

This error message indicates problems with your AGP support. Exit X and type as root
/sbin/insmod agpgart
. Restart X and try again
fglrxinfo
. If it works now, you are ready for YASARA. Note that this fix is temporary.

  • Run YASARA.

If you still have problems, make sure that you really install the latest ATI driver. The first releases were very buggy, and only with version 3.7.6 did ATI reach good quality. Version 3.7.6 works well with most Radeon cards, e.g. the 9200, 9600 series.

If YASARA finally runs, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .