Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Working with extremely large protein structures

YASARA has been designed to run fluidly with very large structures consisting of several 100000 atoms. Here are some hints to maximize the performance:

  • Make sure that YASARA has enough memory available: edit the file 'yasara.ini' and set the 'Memory' field to about 75% of the memory present in your computer. E.g. if you have 1GB installed, set 'Memory' to 768. YASARA always shows you the percentage of free memory in the botton left corner after 'Mem'.

  • In YASARA Model+ you can gain speed by disabling the Undo/Redo functionality. Click Options > Undo levels and set them to 0.

  • Make sure that YASARA's built-in antialiasing is disabled: Click Window > Antialiasing.

  • Disable shadows: Click View > Lighting and set the 'Shadow density' to 0.

  • Choose an efficient way of drawing your molecule. Press <F4> or View > Scene style > Trace to show a Calpha trace, which is the fastest style.

  • If you work with surfaces, lower the grid resolution (choose a larger number at View > Show surface > Parameters)

  • Work with multiple objects instead of a single one: e.g. when looking at the foot-and-mouth virus, the PDB file 1qqp contains only one capside fragment with 5200 atoms. Instead of downloading the whole biologically active oligomer, click Edit > Oligomerize and let YASARA Model+ build the complete capside with 60 fragments and 312000 atoms. Many operations (e.g. adding hydrogens) are much faster when applied to many small instead of one huge object. YASARA will also show many more progress bars.

  • OpenGL allows to show objects only up to a certain maximum depth. To prevent objects from disappearing when you move them too far away, YASARA simply blocks mouse movements beyond the maximum depth. If you feel the need to move the object further away, click on View > Atom appearance > Size and reduce the atom size (which is essentially the same as moving the near and far clipping planes away). You can also use the keyboard to move the scene beyond the far clipping plane (keys 'Y' and 'U' on English keyboards).

  • When you end up in the middle of the structure and lose the orientation, click on the zoom icon in the top menu line to center the scene.