Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Work with YASARA and your text editor in parallel

To quickly develop a movie, follow these steps:

  • Write the initial part in your text editor (e.g. loading a structure or image), save it. You can use the StopMacro command to stop the macro at a certain point.

  • Run the macro in YASARA (click Options > Macro & Movie > Play macro, browse to the directory of your movie and select the .mcr file, or simply press <Ctrl>+<M> to rerun the last macro. At this point it is important that you run your movie as a normal macro, otherwise YASARA will restore the current scene after the movie ended - which is usually not what you want while debugging).

  • Move the protein you loaded to the right spot, get its current position and orientation and use these numbers in the macro with Pos and Ori or AutoMoveTo and AutoRotateTo to animate the protein. After some time, when you are used to YASARA's coordinate system, you will know the right numbers just by looking at the screen.

  • Iterate these steps.