Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Weak strings are enclosed by single quotes

You already met some weak strings in the section about explicit evaluators. They are called weak because of two reasons:

  • Explicit evaluators inside the string are indeed evaluated.
  • When a weak string is explicitly evaluated, it loses the single quotes.

Example:

a = 2
b = 3
# Assign '5' to MyWeakString
MyWeakString = '(a+b)'
Print 'Result is (MyWeakString)'

Result is 5

Note that the result is 5, not '5', not (a+b) and not '(a+b)'.