Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

WinTexture

-

Set window background texture


CommandArgumentDatatypeDefault Min Max
Format: WinTexture Number = Background textureINT- 1 9
Python: WinTexture(number)
Menu:Window > Background texture
Related: StyleWin , AnimateWin, WinFont
Required:


The WinTexture command selects the background image to be shown inside windows.

You can display your favorite picture as a Window background by saving it as bmp/ysrbkgr?.bmp, where you replace ? with any number from 1 to 9. If the file already exists, make a backup first.

Example:
WinTexture 5

Load file bmp/ysrbkgr5.bmp and display it as the window background texture.