Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

WinFont

-

Set window font


CommandArgument DatatypeDefaultMinMax
Format:WinFontLocation = Header | Body,STRING - --
  Name = Font name STRING---
Python:WinFont(location,name)
Menu:Window > Font
Related:StyleWin , AnimateWin, WinTexture
Required:


The WinFont command chooses the fonts used for text in the window header and the window body.

The currently available fonts are Arial, Baikal, Lucida, Segoe, Tahoma and Times.

If you choose a different window style , the fonts are changed to the respective defaults automatically.

Example 1:
WinFont Header,Times

Choose the Times font for the window headers.


Example 2:
WinFont Body,Arial

Choose the Arial font for the window bodies.