Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

WarnIsError

-

Treat warnings as errors


CommandArgument DatatypeDefaultMinMax
Format:WarnIsError Flag = On | OffSTRING - --
Python:WarnIsError(flag)
Menu:Simulation > Simulator > Warning is error
Related: OnError
Required:


The WarnIsError command sets the way how simulation warnings are handled.

When a simulation warning occurs (cis-peptide bonds , wrong isomeres, or cell explosion), YASARA normally corrects the problem and continues. If you are running a realistic simulation, that is not what you want, because the warning may indicate a serious problem, and its automatic correction is certainly not 'realistic'. WarnIsError allows to treat warnings as errors, halt any running macro and also exit YASARA with an error code .

Example 1:
WarnIsError On

Treat all simulation warnings as errors.


Example 2:
WarnIsError Off

Just continue a running simulation, even if something went wrong.