Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Wait

-

Wait for certain time period or condition


CommandArgument DatatypeDefaultMinMax
Format 1:WaitSteps = Number of steps to wait, INT---
  Unit = Cycles | Seconds | Femtoseconds STRINGCycles - -
Format 2:Wait Forever | SpeedMax<X | ExpEnd | PluginEnd | Key | Button | LeftButton | RightButton | ContinueButton | MarkedAtom | MarkedDistance | MarkedAngle | MarkedDihedral STRING---
Python:Wait(steps,unit=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:PlayMacro
Required:


The Wait command holds a running macro for a given number of screen update cycles (Unit='Cycles', the default), a given real life time (Unit='Seconds'), a given simulation time (Unit='Femtoseconds') or until some special events take place (which are explained in the examples below).

If Wait is used with the default unit 'screen update cycles' during a simulation, it depends on the current TimeStep and the number of simulation steps per screen update how long the command will actually wait in terms of simulation time. That is why the unit 'Femtoseconds' should be used for waits during a simulation.

Requests to wait for clicks on buttons are ignored when YASARA is run without graphics.

Example 1:
Wait 500

Wait for 500 screen update cycles, then continue.


Example 2:
Wait 200,Unit=Seconds

Wait for 200 macrocosmic real life seconds.


Example 3:
Wait 200,Unit=Femtoseconds

Wait for 200 microcosmic femtoseconds during a molecular dynamics simulation.


Example 4:
Wait Forever

Wait forever or until the user opens the console by pressing <SPACE>.


Example 5:
Wait ExpEnd

Wait until the current experiment ends.


Example 6:
Wait SpeedMax<2000

Wait until the speed of the fastest atom drops below 2000 m/s.


Example 7:
Wait Button

Wait until the user presses a mouse button.


Example 8:
Wait LeftButton

Wait until the user presses the left mouse button.


Example 9:
Wait ContinueButton

Show a continue button and wait until the user clicks on it.


Example 10:
Wait MarkedAtom

Wait until the user clicks on an atom. The number of the atom can then be obtained with the 'MarkAtom' command.


Example 11:
Wait MarkedDistance

Wait until the user clicks on two atoms to mark a distance. The numbers of the atoms can then be obtained with the 'MarkAtom' command.


Example 12:
Wait MarkedAngle

Wait until the user clicks on three atoms to mark an angle. The numbers of the atoms can then be obtained with the 'MarkAtom' command.


Example 13:
Wait MarkedDihedral

Wait until the user clicks on four atoms to mark a dihedral. The numbers of the atoms can then be obtained with the 'MarkAtom' command.