Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Volume<Atom|Res|Mol|Obj|All>

-

Calculate volumes


CommandArgument DatatypeDefaultMinMax
Format:Volume<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Type = VdW | Molecular | Accessible | AllSTRINGAll - -
Python: resultlist = Volume<Atom|Res|Mol|Obj|All>(selection1,Type=None)
Menu:Analyze > Volume of
Related: Surf , Mass
Required:


The Volume command calculates the Van der Waals, molecular or solvent accessible volume of the selected atoms. The difference between these volume types is explained at the ShowSurf command and in the help movie 'Surfaces I'.

The volume is computed numerically by first creating a grid-based representation of the selected atoms and then summing up the (partial) grid cubes that are inside. That is why the result becomes more accurate if the grid resolution is increased.

The surface environment is ignored when calculating volumes.

IMPORTANT: The above two points imply that it is currently not possible to consider the influence of the environment on the volume of the selected atoms, i.e. covalent bonds to non-selected atoms will not reduce the calculated volume. Therefore the volume calculated for a group of overlapping residues will be smaller than the sum of the volumes calculated individually for each residue.

The molecular (solvent excluded) volume is always calculated using a Gaussian approximation, even if the MSMS program is selected to create molecular surfaces. As this approximation is calibrated for proteins, the molecular volume calculated for a single atom may differ from its Van der Waals volume (even though they should be identical).

Note that the calculated volume depends on the simulation state: when no simulation is running, each object has its own local coordinate system , and the volume calculated for two objects is just the sum of the individual objects. During a simulation, all objects are transferred into the common coordinate system of the simulation cell, where they 'feel' each other. Consequently, the volume calculated for two objects is smaller if the objects overlap. Contrary to surfaces, volumes cannot be calculated during a simulation with periodic boundaries.

Example 1:
VolumeObj 1crn,accessible

Calculate the solvent accessible volume of object 1crn in A^3.


Example 2:
VolumeRes Protein,molecular

Calculate the molecular, i.e. solvent excluded, volume of all protein residues.


Example 3:
vol = VolumeRes 20-30,VdW

Calculate the Van der Waals volume of residues 20-30 and assign the result to variable 'vol'.