Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Using the console

The console size and font can be configured separately .

Space Bring up the console
Space If pressed a second time, extend the console to full size
Return Leave the console
LeftButton Select text and copy to clipboard
MiddleButton Paste the clipboard
Ctrl+V Paste the clipboard
PageUp Scroll console one page down
PageDown Scroll console one page up
MouseWheelUp Scroll console half a page down
MouseWheelDown Scroll console half a page up
Ctrl+CursorUp Scroll console one line down
Ctrl+CursorDownScroll console one line up
CursorUp Show previous command in the history
CursorDown Show next command in the history or clear input line
Home Move cursor to start of line
End Move cursor to end of line
Ins Toggle the HUD
Ctrl+Ins Change the HUD
Esc Interrupt a running macro that does not Wait