Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

UserInput

-

Set user input


CommandArgument DatatypeDefaultMinMax
Format:UserInput Status = On | Off STRINGOn - -
Python: UserInput(status=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:PlayMacro, OnError, StopMacro
Required:


Some movies are non-interactive, and mouse movements made by the user disrupt the animation. In such cases, the UserInput command allows to disable any potentially disturbing user input.

The UserInput setting is automatically changed to the default setting 'On' when a macro stops.

Example 1:
UserInput Off

Do not allow the user to move the scene.


Example 2:
UserInput On

Allow all user input.